Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig51
Contig Information
Length 1074 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13f16    rwhei13f16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit MADS-box transcription factor TaAGL31 [Triticum aestivum] >gi|95982215|gb|ABF57948.1| MADS-box transcription factor TaAGL9 [Triticum aestivum]
Score 1163
Evalue 2.24059e-125
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig51
CTGGAGCCCCTCCTTTTTCTGCCTTCGGCTTGGGTCCTATATTATAAACCAAAGGGAGGAAGGACAGCTAGCTAGCTGTATCAGAGAGCCCCATACCTAG
TCGATCGTCTGCTCTCTTCTGCCTAGCTAGAGTTCCGGGCTGAGACTAAGAAGAGGTCGAGATGGGGAGGGGAAGGATTGAGATCAAGAGGATCGAGAAC
ACCACTAGCCGGCAGGTGACCTTCTGCAAGCGCCGGAACGGGCTCCTCAAAAAGGCCTACGAGCTCTCCGTCCTGTGCGACGCCGAGGTGGCGCTCATCG
TCTTCTCCAGCCGCGGCCGCCTCTACGAGTACTCCAACAACAGTGTCAAGGCTACAATTGACAGGTACAAGAAGGCACATGCTTGTGGCTCAACCTCTGG
GGTACCTCTCATAGAAGTCAATGCTCAGCAATACTACCAGCAAGAAGCTGCAAAGCTGCGCCACCAGATCCAGATGCTGCAAAGCACTAACAAGCACTTG
GTTGGTGATTCTGTTGGGAACCTGTCACTCAAGGAGCTGAAGCAACTCGAAAGCCGGCTTGAGAAAGGCATTGCGAAGATCAGGGCCAGGAAGAATGAGC
TCCTATCTTCTGAGATCAACTACATGGTCAAAAGGGAGATAGAGCTTCAGAGTGACAGCATTGATCTCAGAACCAAGATTGCGGAGGAGGAGCAGCGGTT
GCAGCAGGTGACTATCGCCAGGCCCTCGGTGGCGCCGGAGCTGAACCCTTTCACCGCACTGGACATGAAGTGCTTCTTCCCTGCCAACCTCTTCGAGGCG
GCGGTGCATGCGCACGCGCAGGCACAGGCTCAGGCTCAGGCTCAGGCCTCGCTTCAGCTGAACCTAGGCTACCAGCAGCTTGCTCCACCGGGCGCCGGCG
ATGTGGCTCATCAGTTCTAGTCAACCTGCAGGAGCTCTTGCTTGACTACACACACTGCAATAAAACTGGAAAGTCGTCGGCAGTGTTATCAGTACTCAAC
TGTTCCGGTCAAACCGTCTGGCTAAGATATATGTGTGCTAAGTTTTATTGTCTCAAGTACCTCTAAATTGCCGC
page-top