Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig50
Contig Information
Length 858 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13f18    rwhei13f18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 203
Evalue 3.25377e-14
Total Hit Count 161
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig50
TCCCTTTTCGCCAGATCCGACGCCCTTCCGGCTTGTCGTTGCCTCGCCGCCGTGACAAAGTTGGGAGAAGGGGGTTGGCCGTCGTCTTGCGGTTGGGCCG
GAGCAGCGGTGGGCTGGACGCCGCTTCCTGCTGTCTTCGAGCGATGGGAGAGGGTTAGGGTCTGTCGTTTGCCGTTCGATTGGTGACTGTTGCGGGTTGG
CAGCGCGCCGTGTAGCTGCGAGACAACTTCCTTGTTGATCTGCCGTCCTGCTGCAGTGTTATATACTGTCGAATTCCAAAAACGAGGTCTGCCACACGCG
CATATCCTCATCTGGCGTAAAGGAGACAAAGATGGTGATCACTGCCCTAGCTGCTCTTGTCCCAGGAAACAAGAAGTTGACTATTCGTGTGTATGTCTCA
AGGCTGTGGCAGCATCGTGGAACTACTGATAATGGTCCTATCATTCATACTGACATGGTGCTTGTGGATGCTGAGGGTTCTCATATCTATGCTGAGATCT
CTAAAGACTGGGTAAGCAAGTTTATGGAGAAGCTCAGGGAAGGCTGTGCTTATGAGATTTGTCAGTTTCTGGTGTTCCCAAATAAGCGTTACTTTAAGGC
CGTCGATGCAGCAAACATGATCTGTTTCAATAGATTCACTACGGTCAATCCTAATACCGACCTGGAGGTCGCGTTCCCGTTTTGCACTATGCACCTGTCC
AACCTTAGTGTAGATTATTTGTAATCAGTACTATGCCCCAGTATACTTGCATAAGACTACTACCCTTTGCTATTGTAATTGTAATCAGTACTATCTAGAT
GGATGATAGCAGGCAATGTATACCTGCATAAGACTACTACCCCTTAGCTCTCTGATTT
page-top