Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig49
Contig Information
Length 508 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13g01    rwhei17f07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os07g0498300 [Oryza sativa (japonica cultivar-group)] >gi|33146542|dbj|BAC79719.1| unknown protein [Oryza sativa Japonica Group] >gi|50509990|dbj|BAD30453.1| unknown protein [Oryza sativa Japonica Group] >gi|113611245|dbj|BAF21623.1| Os07g0498300 [Oryza sativa (japonica cultivar-group)] >gi|218199665|gb|EEC82092.1| hypothetical protein OsI_26096 [Oryza sativa Indica Group]
Score 390
Evalue 2.02418e-36
Total Hit Count 47
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig49
TCCACCCCGAGAGGAGAGCGCAGCGACATGCCGGCGACGCCGACCATCATCGGTGCCCTGCTGGGGCTGGGCACCCAGATGTACTCCAACGCCCTCCGGA
AGCTCCCCTACATGCGCCATCCCTGGGAGCATGTGCTGGGAATGGGTCTGGGTGTAGTGTTTGTAAACCAACTGGTGAAGTTTGATGAGAAGGTCAAGGT
GGACCTTGATAAGATGCTTGAGCGTGCGAAACACGCCAATGAGCAGCGCTACTTTGACCAAGACGACGATTAGCTGTTCAAATTTGTTTGGCGGCAACCG
GGCTTTTTGCAGTTTGCTTTGGTCACAAAAACTGGCTCCGCATTTCATCTGCGATAGTGTAATAAACTGATGTTTCACAGTACTTGGGTTGTACTTGTAC
GGGAGACCTTTTTATGGTACTTGAAACCTCNTGCCNAATTCNGCACNANGCGGGCTGACCGGCATCGGCGCGTGGGANGCGNTGGTGCTNNANATCGNCN
TNACCTTC
page-top