Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig46
Contig Information
Length 669 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13o02    rwhei13o02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit excinuclease ABC subunit B [Rhodopseudomonas palustris HaA2] >gi|86574281|gb|ABD08838.1| Excinuclease ABC subunit B [Rhodopseudomonas palustris HaA2]
Score 92
Evalue 0.148471
Total Hit Count 18
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig46
CCACCGCTCCCCCACCTTCTTCTCTGCCGGGGCCCCCGCGCCACCAGAAACCCCGCTCCCCACCTTCTTCCTGGCACCGACGCCGCCAGATCTCTCGCGC
CCCGGCCACCGTGGCTCCAACCACCGTCTCCCCGCTCTGCCCCCCCTGGCCACCAGCACTTCCTTCGTGCAACAAGGGTAGCCGAGCACCGCATCCGGCC
GTGGGTTCACGACGAGAACCCACCGGATCCGGCCTCCCAGATGGCTGCGGCCGTGGGGCGTCGAGGTCACCGTGGCCCTCTCCTCCCCAGATCCGAAACC
GATGAAAAGGATTCCTGGGCTAGTGCTCATCAGTCTTGGGTGACTAGTTTTGCGCACGTAGGAGTGCAGCTTGACCAACGGGACGTGCAATTTGGCCCAT
GGCGTCGACGGTTTTCCGGTGAACTCGCGTGTGCACGGGCAGTTCCCTTGGACTATGCACACGTGGTCGTTTTTATGAGGGGTTCACTGTGTATGTTGGA
GAGGTTCGCTCCTCCATGGGGGTCATCTTTTTAGGTAGTTCACTTCCTGAATTGTTTTAACACTCTTTTGTTTTTGTTTAAATCCGGTCTAGTGCAGTTC
GTTTGTCATGTTGGATATGTTCATTTTCATGAAAAAAATAAAAGGTTGATGCAGCCCACTTCGAGGAGT
page-top