Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig45
Contig Information
Length 621 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13n23    rwhei13n23   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os10g0521900 [Oryza sativa (japonica cultivar-group)] >gi|113639703|dbj|BAF27008.1| Os10g0521900 [Oryza sativa (japonica cultivar-group)]
Score 193
Evalue 1.67152e-14
Total Hit Count 71
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig45
GGGGCCTGCCGACGCCGACGGAGGAGCATCCCATGATCTACCGCATGAAGCTCAGGTGTCTGCGACAAGAGGGGAGGACTGCTTTGCNATCTCAACGTAC
CCTATTCATCAGAGACAACATCTCCATGGGCGCCTCCGTGCGCTCTTTTGGCAGCTCGGAGCCATGCTGTCAGAGCTCTTCACCAACTGGACCATCTACA
CCAACAAGGCGGCGACGCTGGTGACGCTGCTGTTCGTGATCGCGGTCAACCTGGCGATCAGCATCCTGCCGCACATGATGCGCCCGGCGCCATGGAGTAC
CTCAAGGGCGTGCTCGCCTCCCCCAGCATCCCGATCTCAACGAGCNTAGCGGCCGCCGTCCTTGTCCTGCTNGAGGAGCAGGAGGAGGAGGGGCGCATCT
AGCCAGCCACAAAGGGCTTGCTCTGTNCCACCACATCATCGGCCTTCTGCAGCATCGAGTTCAATATATGCGGTGTACAAGAGCCCCAGGAGAAGAATCC
CGAAGAAANCCAGCACCCAACTATGTGTTTTAGCTCCCTGGAGCTGGCCATGTTAATATTAGGTGTATTTTATAGTTGAATACCTGATTTGTACTGCCAT
GACTCTAAAGTACTTCGTTTG
page-top