Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig41
Contig Information
Length 819 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13n13    rwhei13n13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0163100 [Oryza sativa (japonica cultivar-group)] >gi|46981338|gb|AAT07656.1| putative nucleic acid binding (PHD-finger) protein [Oryza sativa (japonica cultivar-group)] >gi|113578284|dbj|BAF16647.1| Os05g0163100 [Oryza sativa (japonica cultivar-group)] >gi|125550953|gb|EAY96662.1| hypothetical protein OsI_18576 [Oryza sativa Indica Group] >gi|125592927|gb|EAZ32986.1| hypothetical protein OsJ_016469 [Oryza sativa (japonica cultivar-group)] >gi|215701126|dbj|BAG92550.1| unnamed protein product [Oryza sativa Japonica Group]
Score 641
Evalue 4.87156e-65
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig41
CGCAGCGACTGGCTCGCGCTCGTCGCCGTCCACTCCGATTCGTGGCTTGTCTCCGTAGCTTTCTACTATGCCGCGCGGCTCACCCGCAACGACCGGAAGC
GTTTATTTGGAATGATGAATGATTTGCCAACCGTGTATGAAGTCATCTCAGGTATGAGACAATCGAAGGAGAGGGACAGATCAGGTGGTATTGACAACAG
CGGTAGAAACAAGCTGCCATCAAAGCATACAGTCGAGGCGCCGCCACCACCACGTGCAGAAAATAATGCCAGGGATGCCGATGAAGGCTACGATGAAGAT
GACGGCGACCACAGCGAGACCTTATGCGGAACATGTGGTGGCATATACAGCGCCGAGGAATTCTGGATTGGGTGCGACGTGTGCGAGAGGTGGTACCATG
GCAAGTGCGTGAAGATAACTCCGGCGAAGGCGGAGAGCATAAAGCAGTACAAATGCCCAAGCTGCAGCTCCAAGAGACCTAGGCAGTAGCAGCGCCGCCT
CCTTTTGGCGGGGGACGGCCCCCATGGATGGGGGCCTTGAAGCAGCAGCAGCAGCGGTTGAGACTTTTAGACTCCTTGTGCAAGGCTAACTACTACCGTC
TTGCTATGTTTACTGTACCTTTCGTTTCAGGTTTACATATGGTGATGATGCTAATGCTTGTGAGGGAAGATGACACACATTTTCAAAGCCTTCTAACGTT
TCCATGTCCTGAAGAGGAGTCAAAGGTGTATGTTGCCGGGAAGGGATAGTAGAATGATGAAAATATGTGTAACTTTTCATGGGAAGTTCATGTTCCAATA
ATCCGTGAGGTTTATTATA
page-top