Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig40
Contig Information
Length 1197 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13l14    rwhei13l14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit peroxisome type ascorbate peroxidase [Hordeum vulgare subsp. vulgare] >gi|148250118|gb|ABQ53157.1| peroxisomal ascorbate peroxidase [Triticum aestivum]
Score 1220
Evalue 6.49609e-132
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig40
ATCGCTCGCTCCGCGTTATCTCGTCGCCTCCACCCCTCCGCCCCATTCCCGCTGCTGCTGCACCTCTCTCCTCCTAGCCCAAACACACCTCACCTCACCT
CGCTCCTCGCCCCGCCGATCTCTTCTCTTCTAGTTCTAGGGTCGTCCGCGATGGCGGCTCCGGTGGTGGACGCCGAGTACCTGCGCCAGGTCGACAGGGC
GCGCCGCGCCCTCCGCGCCCTCATCGCCTCCAAGGGATGCGCCCCCATCATGCTCCGCCTCGCATGGCACGATGCTGGCACGTATGATGTGAACACAAGA
ACTGGTGGCGCAAATGGTTCAATTAGATACGAGGAAGAGTACACCCATGGTTCAAATGCTGGCTTAAAAATTGCTATTGATCTCCTCGAGCCTATTAAAG
CGAAGCATCCAAAGGTTACATATGCAGACCTTTATCAGCTTGCTGGAGTAGTTGCAGTTGAAGTCACGGGGGGTCCAACTGTTGAGTTCATCCCTGGAAG
ACGTGATTCGTCAGTTTGTCCCCGTGAAGGGCGCCTTCCTGATGCTAAGAAAGGCGCACCACATCTGAGGGACATCTTTTATCGAATGGGCTTAACAGAC
AAAGATATTGTAGCACTATCTGGGGGCCATAGTCTGGGAAAGGCGCATCCTGAAAGGTCTGGGTTTGACGGTGCATGGACTCGTGATCCTCTGAAGTTTG
ACAACTCATACTTTCTTGAGCTACTGAAAGGGGAATCAGAGGGTCTTCTGAAGCTCCCTACTGATAAGGCATTGTTGGATGATGCTGAATTTAGACGCTA
TGTGGAGCTTTATGCAAAGGACGAGGATGCTTTCTTCAAGGACTACGCTGAATCACACAAGAAACTTTCTGAACTTGGCTTCACACCACGGATCAGTGGC
CTAGCTTCTACAAAATCAGATGTTTCAACTGCTGTTGTACTTGCACAGAGTGCAGTGGGGGTAGCAGTTGCGGCAGCTGTAGTCATCGCGGGCTACCTGT
ACGAGGCTTCCAAGAGGAGCAAGTAAGGGGTTTCATGAGTTCTTGGATGGCATTGCCTTGTTTAGTAAGTATCAAGTTATTCTTAAAAAAATAAGTGCCA
AGTTCAAATAACAGAACGCTAGTGAAGAACAACCAATAGCAGTCTTAAAATATTTCAAACATTCTTGAGGACATCTCCTTCATGTATACGTCATACT
page-top