Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig38
Contig Information
Length 629 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13h11    rwhei13h11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein MGG_05642 [Magnaporthe grisea 70-15] >gi|145022328|gb|EDK06348.1| hypothetical protein MGG_05642 [Magnaporthe grisea 70-15]
Score 83
Evalue 1.43408
Total Hit Count 9
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig38
CTCGGATCGGCCACGGGTCGACCATCCGGCGGCTTCCCAGCAACTTCAAGACGCCGGCGACGCCCTGTTGCGAACCCTAAACCACCCACTTTTCCCCCTC
TCCTCGCCCTCTCGCCCATCGTCCCTCAGATCCGCCGCAGTCGACGCGCCATTGCCATGGCCACCGTCGCCCTCACGCTCCCCGTCGCCCCCAAGCCCCG
CTAGCGTCCAGGTCCTCCGCCGCGTTCCGCTGCGTCGTCTGTGACGAAGAACACGGGCCAGGACCCCCTTCGTCGCCGGATCCACGCCACCTTCGTCCCC
CTCGGTCGCCGCCGACCACCGTCGCCTCGGCCACGCTGCTGCTACTAAGCTCTCGCAGGGCCTCCTTGCGCCTCCCCGATGTTGCAACCAGATGGTGGAG
CCTAGGATCCCGACGCCACCTTCGACGACGACTGCTACTACACTAAGGGTGCCTACTACTACGTGGAGGCCGCCGATGACCAGGAGTAGTTAGGAGGCTC
CCAGGCAGGAGGCCTCGCCTTTTCGATCATGTTGCTTTTGAGCTAGTCTTCTTAAGGTAGACTTGTCTAACCTATGTCTGTACTCAGATATTTTTGCTTC
CACAGACTCTTGTGTATTCGAGCCCTCGA
page-top