Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig37
Contig Information
Length 776 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13n04    rwhei13n04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit orphan steroid hormone receptor 2 [Strongylocentrotus purpuratus] >gi|68566021|sp|Q26622|SHR2_STRPU RecName: Full=Orphan steroid hormone receptor 2; AltName: Full=SpSHR2 >gi|1054912|gb|AAB19174.1| orphan steroid hormone receptor 2 >gi|167859078|gb|ACA04474.1| Shr2 [Strongylocentrotus purpuratus]
Score 85
Evalue 1.30571
Total Hit Count 4
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig37
TCTCCTCGGCCCTGTCCTCCGCCTCCACCTCCCCGCCTCCAAGCGATGACGACGGCCCGAGATCCATGGTGACGGCGGCTGCAGTGGCCCGATGGAAGCG
GCGGCCATCCCTAGCCGTTGCCGCGTGCTTCTGCTACTCACGTTGGCCATGGATCTGCAGCAGGGGCCTCCCTCCTCCGTTTCCCAGAGCCCGCAGCTAA
TTCGCCATCCGGAGATTCGGAGCAGCAAGCGCCGGACGAGGACCGTAACCTGCTGGAGGCCCGAGCGCGACCTCGTCAACGGCGACGACGCCCCGCACAA
GATCAGTAGGAGCTCTCTGCCTCTCCAATTCCATGGACGGCGACGACCGGGACCCCACGCTCAAACCCGACGAGCTTGAACGGCGAGGTCATCCGAGCCG
ACCATCATGATTCCCCACAGAACAATAAGGTCTGTCTCATGGACACCCAAATTTTGTATGCAATTTTCTCAACACCCAGATTGGAGCCTAAGGTTGGACA
TTTTGATGGGACTGCGGATCTTCGGATGTTGGTGCTGAGATTGATGTGGCCCTAGCTACATGTATGATTGCGTACCGGGCTACTTGGTGCTGCCCATCAC
AATTTGCACTGACATGGTAACTTCCATCAAGAGGGCCGACTGCAAGAACTTGAATAGCAACTTCAATAGTTTAAATGTTCTGTTTGTGTGAACTGGATTG
TACTGTTTTTTAACTTTCCCAAGTAATATATGTTGTAAACTATCATTTCATGGAGGATTTTGTAAGCTGGCTATGT
page-top