Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig34
Contig Information
Length 574 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13h13    rwhei13h13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Trypanosoma cruzi strain CL Brener] >gi|70880677|gb|EAN93759.1| hypothetical protein, conserved [Trypanosoma cruzi]
Score 95
Evalue 0.0470112
Total Hit Count 69
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig34
GAATCCTCGGCTCCCTCCCTTCGACACCACCGACGGTGTGTCGAGGTCGATCCGTCGATGTCGCCCCCCTCTCCCGCACCAGACCCCGCGGAGAAGTCCG
AGCCTCCTCCATTGGCCTGCGAGCGTGGCGATGACAAGCGCTAGAGGAACCGTTGCTGCTTGGCTCCTCCGCTGTCTCAGGGTCGTCGCGCCACCACCAT
GCTGTCGCGCTCCTATTCTCCACGGCCCTCCACGGCTCAGCGCTGACGAGGACCGACGGGATCCCCGCCACTGCTTCCTCCACCCAGCGGCGAGAGCTGT
GCCCGCTCTTCACTACGCCGGCACACCACGCTGCTCAGATCCGTCATGGTGGAAACCCGATACAGGTTTCCCTACAGAAGTTGATGGGGGTTTCGAAGAT
CTTCAAGCTGCTGAAGATTTGGGAGATTCGGAAGATCTTTAAGCTATTGAAGATATGGTAGAGTGATTATGCTTTGTTTGTGGAACCTGTACACTTGCTC
TGCTCATTTTGCCGGTTGTTAGGCCACAATATGCTCATTTTGGTTGTGTGGCACCCCAGAAACCATATGTTCTT
page-top