Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig33
Contig Information
Length 180 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13h15    rwhei13h15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100192876 [Zea mays] >gi|195644624|gb|ACG41780.1| hypothetical protein [Zea mays]
Score 96
Evalue 0.0218261
Total Hit Count 9
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig33
GCCGGCCGGGGCGTCGCTGGACATGCGCGAGGTGAACGGGCTCGCCGTGCATCTCAAGTCCGGCCTGCCGCTTGTCGCTAAACTGCGGTTTCGTTAGATA
AACTTGTTGCTATGCAAGAAGAAACTGTAAAAATCTGTAAAAATGTATTGTAGTGTTTGCTTCAAAGCCTAAAAAAAAAA
page-top