Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig31
Contig Information
Length 620 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13i05    rwhei13i05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0132500 [Oryza sativa (japonica cultivar-group)] >gi|113535329|dbj|BAF07712.1| Os02g0132500 [Oryza sativa (japonica cultivar-group)] >gi|125537965|gb|EAY84360.1| hypothetical protein OsI_05735 [Oryza sativa Indica Group] >gi|125580702|gb|EAZ21633.1| hypothetical protein OsJ_005116 [Oryza sativa (japonica cultivar-group)] >gi|215678537|dbj|BAG92192.1| unnamed protein product [Oryza sativa Japonica Group]
Score 76
Evalue 8.94688
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig31
CTCGCTCAACGACATCATCGCCTGCATGAGCGCCAACAACAACACCGCCGCCGCCGTCACGCTCACCGTCGCCGCAGCCGCTACCGCCACCACCGCCGAC
CCGCTCCTCGGCGGCTTCGACGGCGCGTCATTCGAGGACTTCCTCTTCAGATCCTCCCCCGAGATGTTCATGTTCCCAGCCCTGCAAAGCTAGCACCCAC
GCCACGGCCATGGCAGCAGCACAAGCACGAGCGCGCAACAAAAGAGATGATCCATCTTTTTTCCTGATGCTTCTGGTGTTTCAGGTTAATTACTACAGTA
CAAAAAACTGGGAGAGCCGTGGAGTTTTTACCGCACCTAACTAAGCTAGCTGCTGGGGTTAATTAGTTTATAATTATCATGTGTAATCTGAACTGGTGTG
TGTACCAAGTGATGATGGTTCTTAAGCTTAGCATGCATGCATCACCATCATGTGATCCCCCTATGTAAGAAGGAAGAAGCAGTTAGCTCTCTCTCTCCCT
GTGCTGTTGCTCAGACAAAGCAAGTGCCATATATAATTACTCTACTTACTTACTCATCATCTCATGATTTCCTTTTTTACTGTCATGAATGTATTTCTCT
TATTTCTGCTAAAAAAAAAA
page-top