Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig30
Contig Information
Length 390 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13m05    rwhei13m05   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative multidrug resistance protein [Vibrio campbellii AND4] >gi|159174826|gb|EDP59626.1| putative multidrug resistance protein [Vibrio campbellii AND4]
Score 81
Evalue 1.20385
Total Hit Count 17
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig30
CTCGACGGAGCATCTCAGATGGCGGCGAGTTGGCGAAGACAGAGCAACGGCGGAGCTCAGCCGCTCAACGTGAGGGTTCGGCGAGGCGACTTAAAAACCG
CGGGTTCGGCTGAAGTAGTACGAGGCCGACTCGAGGATGAAGGCAGCATCTTGAAGCCAAGGCGATTCGGCGACTCGGTGGTCCGGGGAAGACTCGGACC
AGGCGAGTTGTGGCGTTGAAGATGAAATCCTCCTCCGGGTTGTGGTTGACCAAACATTTTTTTTAAACCGTTCCCAGCTAGCACTTTCCTTGACAGTAGC
TAGCACTTTCCTTGGTGTGACGCGTAGTAGTCTGTGGACTCGTATTGGATTCCCGGTGTGCTTCCCGTGTTTGTCGCGGCAAAAGCTATG
page-top