Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig28
Contig Information
Length 871 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13l22    rwhei13l22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_01897 [Oryza sativa Indica Group] >gi|125525900|gb|EAY74014.1| hypothetical protein OsI_01902 [Oryza sativa Indica Group] >gi|125570363|gb|EAZ11878.1| hypothetical protein OsJ_001703 [Oryza sativa (japonica cultivar-group)]
Score 431
Evalue 1.21198e-40
Total Hit Count 15
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig28
GTCGTCCGCCACTGGCAGGGGCGGCGGCGGCACCGCGTACTCCCGGGAGTGGTACCTGAAGTCATCGCACTGCAGCACCGCGCACAACTGCACACCGCGA
AGTACTCGCGAGCAGGGCCGGTCCTGAGGGCACTCCGCGCGCGCAGTCTCCTCGGCCTCTACTCCTTCTCTTCCCCGAGATTGGCGGAAAATCAGGCTTT
TCTGATTGTTCATTTGTTCGTGAAGGCAAGGTCTTGCGTGAAGGTCATCCTCCTACATCGCTGTGTCAAGCACTCTGATTGCTCGTGTTGATTGGAGTTA
GAAAAGAGGAACCCAGATTTTTGTCCGTGAACTTGATATCCCAAATTATCCCACCAAGAAAGATGGCCGCGTCGTCCTGGCCTGCGCTCCCGGCCACCCG
GCGGGATGTCCAGGCTGTCGTTGCCAAGGACGTGGAGCTGCACTCGCCTCCATTGGTGCACCGTGCCCAATGTCAGTGCTGGAAGAAAAAAAAATGGCAC
ATCTTTATGAGCGCAGGGAGTTTCCCTACCCTGGTGATGAAGAGGCAGTTGAGGAGTTCATAAAAAGTGGGGGTGCTCTAGGTACCACGATCGGGCCCAA
AGGTTTTGCGGATACAAACGTGGACTCTGATAACATGCAGAAGCAACTGCAGTCGAAAAAGTTCGACCAGGAGGCACAAAAGCTCTGGTTCCGAATGAGG
AATGAGGTTGCACATGAACTACAAGAGAAGGGATTTGATGTTGAATGAAGTTTTATTCTTATAAAGGAGGAAATGGTGTCATGCTAGAGTTATCTTTGGA
CCGGTTCAGCTCTGCTGATTGACACAATAGCTAGTAACTTAGAATAAAATGCAAATATTAAACATGAGCTA
page-top