Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig27
Contig Information
Length 870 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13i09    rwhei13i09   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit phosphoglycerate mutase [Corynebacterium urealyticum DSM 7109] >gi|171851199|emb|CAQ04175.1| phosphoglycerate mutase [Corynebacterium urealyticum DSM 7109]
Score 79
Evalue 7.89651
Total Hit Count 1
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig27
AGCCGGCAGCGCCCCCTTCGTCCCCTCCGTCGGCTTCCCCGGCGAGCTACCAAGAAGGAGGAATGGTTCGTCCCTTGGAAGTGCGGTTCGTTCCCTTGTC
CGGCTTTGCACCTGGAGGGGATCCACCACAAGGTCCTAGAGCAAAGAAAGTATCCAAGGCTGCACCTGTGTTTGAAGTCCCTGGGTTATGGACACCCGAT
GTACCTCTAGAGAATGCCTATCGTGACTGTATTAACATGACTGTCGTATACCTTGATTTGCACTTGCCAAGGAAAATGAAGCCTAAGCTTTCTCTGAGAG
AGACCTTCTATATGATATATGGTGGCAATACAATCAAAGAACTTGCGGAGCTTGTATGCGGTCGTCTGAATCTTGAGGTGGGGCATCCAATGAAGTTCAC
CATTGATGGGACTCTTCTGCCGGAAGATTCTGTACTCTCCTCAGTTTACAACAAGTATATTTGGGACGGGAGCATTCTGACACTCTGCTGCTGTGTTGAT
AATGTGAAGAAAATCTTCAACGTGGACCTGTCAGTGAAAGTTCCTGTGACACCACCAGTGCATGTGATTGAAGATGAAGTCCCATTACCCACTCTGAGGA
TCTGCTCTGTCCGGGACGCAAGGAGGGTGTCTATGATGAGCAAGGTTGGAACCTACTTGCTGAAGGATGGTGCTCCAGCTGTGCTGGTGCACGGCACCTA
TGGGGAGGGCGGGTCACTAGTTTTCTATTAGGTTCTGTCGCTGGCACAATAGTCCCATGTTACTTTTGCCGCAAGTCATGACTTGGAGTTGCTTCTGTTA
AGCCCATCTCGTAGTCCTTTTGTGAATGAGGCACCTGTTTACATCCTGTGATCCTTTTGTGTCATGAGGC
page-top