Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig25
Contig Information
Length 485 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13l15    rwhei13l15   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0679400 [Oryza sativa (japonica cultivar-group)] >gi|113565851|dbj|BAF16194.1| Os04g0679400 [Oryza sativa (japonica cultivar-group)] (no hit)
Score 455
Evalue 5.12087e-44
Total Hit Count 0
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig25
AAGCTACGCGACCAGAGGAGAGGAGAGGGAAGCCATGGATGTGCACCAGGGGACGCGGAAGAGGAGGCTTGTTGCCATGCCTTCTCTGCTCGAGGGGGAT
GGCGAGAACCTGCTTCTGCTGAAGTATCTGCGCTCGCCGGCGCCGGCGAAGAGGAGGCTTGTTGCCATGCCTTCTCTGCTCGAGGGGGATGGCGAGAACC
TGCTTCTGCTGAAGTATCTGCGCTCGCCGGCGCCGGCGCCGGCGCCGGCGTCTGCGCCGATGATGCCCAAGCCGCCGCCTCCGTTGGAAGACTTCCAAGG
CCTAGGAGAAGATGGCAAGCCGCGGTGGCCGTCCAAGGAATTGCTCCGTCAGATGTTTGTGGACAGTGCTCCGGCCGGATCGATTCCGCCCGCTGTCTAA
TTAATTACGAGTAGCTTTCTTTCTACTCGATGGTGTGCCCATATGTAATTAATTTTGACCATCGATGATGGCAACTACTTTGTTG
page-top