Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig23
Contig Information
Length 633 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13j01    rwhei13j01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown protein [Oryza sativa Japonica Group] >gi|215692975|dbj|BAG88395.1| unnamed protein product [Oryza sativa Japonica Group]
Score 90
Evalue 0.226779
Total Hit Count 10
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig23
TGAAAACTGTGTTACCATAAATGTCCATCATTGTCCATAGCAGTCCCAAGCGGAAAAAAAATCCTACATGACCGAGTTGTATGGACCCGATCGTGAGACC
CACTCCAGCGCTCGCCAACTGTCCGTCCGAATCTTAATGCAACAGGCGTCTCCTTCCCCGCTTCCCTGTTTCACTCCTTATCTCCTCCAACACACCCAAA
ATCCAGTCGCTGGTCATGCCATTCTTGCCACCGCTTGACGGCACGGCGCGCCCGCACCACTTTCCCCTGGGAGCCTTGCCGCCAATGGTGCCGGGCGCGG
TGGTCGCCCCCGCCTCATCCCCCTTCCCTGTTTGCAAATCTAGATTGAAACTCAAACCATTTATTCTGCTAGATATGCTTGTACTGAAATTATTATCTTA
TACATTGACAGAGGATGGAAGAACCAAAAGGTAGTTGATCAGCAGGATGGCAAGAGGAAGACAAGAGCCAAATTAAAGTTTGTTTCTGTGCATGTCTGTA
TCTATCAAGATTCAGTGCTATGTAGAAATGTCCCTGAGATTTGTTTCCCTCAACGAGACCAAACAATCAGGAACACAAGTAGGATAGTTGATGCTTTTTT
CATTTTTCTTCTGATAAAAAGGAATCTTCATCT
page-top