Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig21
Contig Information
Length 592 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13j20    rwhei13j20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 293
Evalue 5.5393e-25
Total Hit Count 13
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig21
GCCGCCTGCCTCTGTTCCTCCCGCGCAGCGACCCGGCGGCCGGCGACCAAGGCGGTGCCCGCGGCGAGGTCTTCGCAGCCTAGGGTTCGGCTTCACTCCT
CCTCCTCTCCGCATCTCGGTCTTCACCCAGGCGCGGCGGCGGCGCCATCCCGCCCGTCAGCTCTCGTCACAGAAAACGCCGCAGGAAACAATCTGAATCA
AGGCACGGATCGGCGTGATGTCTTTCCTGAGGCTGTTACCTCAAAGGTTGCCCCAATTTGTTAGGCAGGTGGAGCGAGATGTCGAGACTGTAATCAATGT
TCTGCAGCCAGGTCCAATAGGAATTGTGGAGCATAAGTTCACTGATGCAGAGATCCGCGAGGCGCAAGTCACTGTAAGGAGTGCTGTTGAGAAATGGCGA
AGGAACAGTGCTCTGGAGAGAAATCTTGGCACTGGTTCTTTTCATAAATCGAAGTAGCGCTCTATGTCATGACTTGGTGCAGCGCACCAATACTGAAAAT
AAAAGTGTGCCATGGTTGCAACTGTTGGTCTTGGTGTANTTAATGTGTTTTCTCTGTCAGTGAACCAATGCAATTGATCATGATATACCTCA
page-top