Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig19
Contig Information
Length 395 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13i16    rwhei13i16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|195614668|gb|ACG29164.1| hypothetical protein [Zea mays] >gi|195616076|gb|ACG29868.1| hypothetical protein [Zea mays] >gi|195646646|gb|ACG42791.1| hypothetical protein [Zea mays]
Score 448
Evalue 3.31887e-43
Total Hit Count 157
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig19
ATCTCGAAGCGGTTTGTGTCGGCGTCGCTGACCCACCGGTCGACGTGCCGGCAGGTGGCGGTTGCGGGCACCAACTCCAAGGACGTGAAGGCGGCGCTGA
CGTCGCGGTCGGACGTGCCGGCGTGCCTGTCGGTGGGGCGGTTCCTGGCGGAGCGGGCCAAGGAGGCGGACGTGTACGCGTGCACCTACACGCCCCGGGA
GCGGGACCGGTTCGAGGGCAAGATCAGGGCCGTTGTGCAGTCGCTCATCGACAACGGCATCCACGTCAAGCTCTACCTCGACTGATCCTTTCTCTTTTTT
TGCTGGTGTGTGTCTGTTGCCGCTCTGCTTTCTACGCCTGCTGCTGAAGAAGAGTGTTGGCTTGGTTGAATGCGCTGTGACTTTTGCGGATGTCC
page-top