Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig18
Contig Information
Length 420 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13i17    rwhei13i17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Oryza sativa Japonica Group] >gi|55297450|dbj|BAD69301.1| hypothetical protein [Oryza sativa Japonica Group]
Score 77
Evalue 3.47547
Total Hit Count 9
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig18
GCCCCTTGCTGCCGCCCCCACCCACCGACGACCTCGCTCCCGGGCTCCGCCACTCGTCTCCGACGCCTTTGGATCTCGCCGAGCCGTCGCCATCGTGCCT
CCTCACCGCCGCGAAGGTATGGTGCGAACAAAGGAGGGGTCGCACTCCCGCGCGAACGAAGGAGCTAGGGTTCTCCGCCACCGCCACTGCAGTCGGCCCT
CCGGCGAACCTCCAGCCCGCGCCGCCGCCTCCCGGAGCAGCACTCCTCTGCTGGCCCAGGTATTTCAGTGGCTGCTGCTGTACTACTTGTGATGATGTTG
CTGCTGTACTACTTGTGATGCTGCTACTGTAGAGTTGATCATTATATTCACTGAATTTTGTCAACTTTTGATGCTGCTGCTACTATAGATCTTCTGAACT
TGTGATCTTCAAAAAAAAAA
page-top