Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig17
Contig Information
Length 232 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13k22    rwhei13k22   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit caleosin 1 [Hordeum vulgare] >gi|34538475|gb|AAQ74238.1| caleosin 1 [Hordeum vulgare]
Score 129
Evalue 3.31586e-06
Total Hit Count 5
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig17
GGCCATCCGGCGGATGTACGACGGCAGCCTCTTCGAGTACATGGAGAGGCAGCGCATGGAGCACGTCAAGATGTCCTAGATCGCCGTGTGTCCGTCGTCG
GTGGATCTCGCAGGGGCGGAGCTGCACCCACCTGTGATGCTTTCCGTGTCCTTGTGTGTATGTACAGCAGGCCACAGATCCATGTGGTGAAAACATAAAT
AACGCGATATGATATGCCATGTAAAAAAAAAA
page-top