Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig16
Contig Information
Length 950 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13i19    rwhei13i19   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit pollen-specific protein SF3 [Zea mays] >gi|195650441|gb|ACG44688.1| pollen-specific protein SF3 [Zea mays]
Score 876
Evalue 3.50978e-92
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig16
TCGCCGCGGCACTGTGAGCCGGCCCGATCGAGCGAGCCGCCCCCCACGCACCTCAAGAAACCGCCATAATTCCATCCATCCATCCGCTGCCGCGTCCTAC
GCGGCCATTTGGGGCGCTCGTGGGGTGTTCGTCACATCAACCAGGCCAAGATCAGATCGGCGGCGACGACGGCGACCATGTTCAGCGGGACGCAGCAGAA
GTGCAAGGTGTGCACCAAGACGGTGTACCCCATGGACCAGCTCTTCACCGACGGCGCCGTCTTCCACCGCGCCTGCTTCAAGTGCCACCACTGCAAGTCC
ACCCTCTCCTTTAGCAGCTACTCCTCGTTCGAAGGGGTGCCCTACTGCAAGCCCCATTTCGCGCAGCTGTTCAAGGAGACCGGGAGCTACAACAAGAGCT
TCCAATCACAATCACCCGCAAAATCTGCAACGGAGAAGCTGACTCCTGAGCTGACCAGATCGCCAAGCAAAGCTGCGGGCATGTTTTCGGGAACACAGGA
CAAGTGTGCCACTTGTGGTAAAACAGCATACCCTCTTGAGAAGGTAACAGTTGAAGAGAAGTCCTACCACAAGTCCTGCTTCAAATGCTCTCATGGAGGC
TGCGCCCTCTCGCCGTCCAACTACGCGGCTTTGGAAGGCATCCTCTACTGCAAGCACCATTTCTCCCAGCTTTTCAAGGAGAAGGGGAGCTACAACCATC
TGATCAAGTGCGCATCGGTCAAGCGCGCAGCAGAGGCGCAAACAGCCCAGGCGGCAGCACAAACAGCGCCGGCGGCTGCTGAATCCTCCTGATTATGCTG
TCATCTTTAAAGTGGGCTTTGAGGGCGAAAGTTTGGAAAGCCTTGCTCTTTTTTTACGATTGTAACCTGCTGTGTGCTGTGTTCTAGCTCTGGGGATACC
AGGACCATATTTCGTGTCCCCATATGTGGCTAGCTCGATCACGTTGTGAA
page-top