Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig15
Contig Information
Length 409 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13k14    rwhei13k14   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0661000 [Oryza sativa (japonica cultivar-group)] >gi|113533308|dbj|BAF05691.1| Os01g0661000 [Oryza sativa (japonica cultivar-group)] >gi|215678875|dbj|BAG95312.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215740577|dbj|BAG97233.1| unnamed protein product [Oryza sativa Japonica Group]
Score 368
Evalue 6.35368e-34
Total Hit Count 32
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig15
GCTGCGAGCGTGATGGCTTTTACATACTCGGGGTTCCAATTAGTTGCAGAAGTGCACTACCTTGTCACAGGGAGGCGCATAATTGGAGGCCCCTGGGGGA
ACTACTTCAATCTCGCCATGGATCAGGTATTGGCTTACCTGCTGCTGTCAGCATCTTCAGCAGCGCTTTCTCGCAATGATGTGTGGGTGTCAAGATTTGG
CGTGGATCAATTTGCCAAACTTATCAATGCCTCAGGCTCAATGGCGTTCTTAGCTTTCATTGCTCTTGGTCTGAGCTCCATCATCTCTGCTCATCGTGTA
TTCAGCTCAATCCCTTAAACCTGTGGTGTGCATTACTGATGTAAATATTATGCTCTAGATGTACGTTGGCATGCCGCCCGTGCCGCCCTTTTTCTCTGCA
AAAAAAAAA
page-top