Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig13
Contig Information
Length 1159 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13j03    rwhei13j03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0296400 [Oryza sativa (japonica cultivar-group)] >gi|108707648|gb|ABF95443.1| Eukaryotic translation initiation factor 2 alpha subunit family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113548300|dbj|BAF11743.1| Os03g0296400 [Oryza sativa (japonica cultivar-group)] >gi|125585924|gb|EAZ26588.1| hypothetical protein OsJ_010071 [Oryza sativa (japonica cultivar-group)] >gi|215679025|dbj|BAG96455.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215707003|dbj|BAG93463.1| unnamed protein product [Oryza sativa Japonica Group]
Score 765
Evalue 4.27368e-152
Total Hit Count 257
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig13
ACCCCCCGAACCAAAACCCAAGCAAACCCTAGATCCGCCGCGGCCCCCTCCAACTCCGGCGACGCCCCCCACCCGGTAGGCGGAGAAGATGCCGAACCTC
GAGTGCCGGATGTACGAGCCGCGGTTCCCGGAGGTGGACGCCGCGGTGATGATCCAGGTCAAGCACATCGCCGACATGGGCGCCTACGTCTCCCTCCTCG
AGTACAACAACGTCGAGGGCATGATCCTCTTCTCCGAGCTCTCCCGCCGCCGCATCCGTTCCATCTCCTCACTCATCAAGGTCGGCCGCCAGGAGCCCGC
CATCGTGCTCCGTGTCGACCGCGACAAGGGATACATCGACCTCTCCAAGCGCCGGGTCTCCGAGGAGGAGGCGCGGTCCTGCGAGGACAAGTACAACAAG
TCCAAGCTCGTGCACTCCATCATGCGCCACGTTGCCGAGACCCTCGAGATCGACCTCGAGCCCATCTACCAGCGCATCGGCTGGCCGCTCTACCGCAAGT
ACGGCCACGCATTCGAGGCCTTCAAGCTCATAGTTGCTGACCCCGACGCCATCCTGGATGTGCTCACCTACGAGGAGAAGGAGACCGGCCCTGACGGCCA
AGAGGTGACTAAAGGTGGTGCCTGCTGTCACCCCTGAGATTAAGGAGACCCTGGTCCAGAATATACGGAGGAGGATGACACCGCAGCCACTCAAGATCCG
TGCTGACGTTGAGATGAAATGTTTCCAATTTGATGGGGTGCTCCATATTAAGCAAGCCATGAGGAAAGCTGAAGCTGCTGGGAACACTAATTGTCCTGTG
AAGATTAAGCTAGTTGCTCCTCCTCTTTATGTACTGACTACACAAACTCTCGACAAGGACCAAGGCATCTCAGTTCTCACTGATGCAGTTAAAGCGTGCA
CAGCGGAGATTGAAAAACACAAGGGAAAGTTGGTAGTGAAAGAAGCACCTAGAGCTGTGAGTGAGAGGGAAGATAAGCTATTGAACGCCCAGTTGGATAC
CCTGGTTGAGCAAAACGCGGAGGTTGCTGGTGATGATGACAGTGAAGATGAGGAAGATAAGGGAATGGGCGATATCGACCTCACAAATTCTGGCGTCCAT
GCGGACTGAGTCTACATTAGTCGATTTGGATGAGATTTGTTGTATAGCATCAGCCAAGA
page-top