Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig10
Contig Information
Length 916 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13k06    rwhei13k06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_005256 [Oryza sativa (japonica cultivar-group)]
Score 294
Evalue 8.13322e-36
Total Hit Count 63
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig10
AAGAAATTGAACCCATTGTAACAATGGTCAGAAAGATCTTCCGTGAATCAAGTGATGGCATAAGGCTTCCCCTGGAGGACGAAAAGTTTATCATAGAAAA
AGTTCTGGAGCACCACCCTGAAAAGGAAAAGAAGGTGTCTGGTGAAATTGATCATATAATGGTCAACAAGCACCACGTTTTCCAGGACAGCCGGTGCTTC
TATGTTGTGTCATCAGATGGGACCCCAAACAGACTTCTCCTACATCAAGTGCATGGACAACTACGTGAGGAAGAACCACGAGGAGCACGCCGAGCTCATC
TGCGAGATGCACTTCAAGAAGCGCAACCGCGATCGACCACCAACGGTCGACGGAGCCGCGGCACCAGCCACTGAAGCCGGGGCGTCTCAGCCGGCTCCGG
GTGAGGACTTGGAAGCCGCTCTGCCAGGCCCACCGCCAGGAACTCCACCTCCTACAGCGATCACCCAGCACGAGACTCCAGCTTCTCCGGCTGCGGCTCC
AGAAGATGATCTGCCTCTGCCTCCTCCCCCTCCACTGACCCAGCATGAGGATGGAACGCCAGAAGATGATCTGCCGCTGCCTCCTCCTCCTCCACTGCCC
CAGCAGGAGGCTGGAACGCCAGGTTCAGCGGCAGCGGCAGGAGCCGTCGATGACAAGTGGGCAGGGGCCGGCGATGACAAGTGGGCGGGAGGCGCCGATG
ACAAGTGGGTCTAGTGGTTGCTTAGGGTTTCGAAATGAACTGAACTGGTTGTACATACTGCTCGTAGCGTCCCGTGCTGAAAAACCTTTCTGCTTGCCCT
GACAGACTTGATGTAGAGGGTTGGTGGCAGTAGCCGTTGTTAGACCTGATGATGGGCTGCGTTTCCAGTCGTATGCGATGCGTCTTCCGGATGAACCCTG
TAAATTCTGGGAGGTC
page-top