Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig9
Contig Information
Length 539 bp
Tissue Dormant seed with water absorption after breaking
Clones 2 Clones [Download: CSV  ,  FASTA ]
whei13k02    rwhei13k02   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit fb27 [Zea mays] >gi|195653893|gb|ACG46414.1| fb27 [Zea mays]
Score 386
Evalue 7.06177e-36
Total Hit Count 92
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig9
TCGTCGTCTTCGGCCTCCTCAACTCGCTCTTCGAGGGCCGCGCCGTCGCCAAGCTGCCCTTCGCGCCCGTCCCGCTCGTGCAGCGCATGAGCCACCGCGG
CCTGCCCGGGAACGACCCCACCGACTGCGCCATGGTCTTCCTCTACTTCCTCTGCTCCATGAGCATACGGACAAACCTCCAGAAGCTGCTCGGCTTCACG
CCGCCCCGCGCGGCCGCGGGGGCCGGCGGTGGCCTCTTCGCCATGCCCGATCCCAAAGCCAATTGAGCTTGATGATCCCCTCTTCTATACATACATGTGA
TGCACCTGGTCTGAAGCAAAGCATCTGAGTTGGTCTCCCGGAAAGAGTTGCTGCCCTGAAAGGAAGATAAATAACCTACCTAGTCGCTCAGAGGAGAAAC
ACTGCAAGACACTGTAACGACACAATTCATTTTTTCCACCCATGATAAGCAGGCGTGAACCGTGCGTAGGCTGGCTGTATCGATCATGAACATTCTCGAG
TTCACCCGAAGCAATCTGTTGCCGGGTTTGTCGTAGGGT
page-top