Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig8
Contig Information
Length 609 bp
Tissue Dormant seed with water absorption after breaking
Clones 1 Clones [Download: CSV  ,  FASTA ]
whei14l06   
Homology (BLAST) Top Hit metallothioneine type2 [Hordeum vulgare subsp. vulgare]
Score 95
Evalue 0.0541065
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig8
CAAGCCTCTTCATCTCCGAAGCTCCAACCCAACCGAGGATGTCTTGCTGCGGAGGAAACTGCGGCTGCGGCACCGCCTGCAAGTGCGGCAACGGCTGCGG
CGGCTGCAACATGTACCCAGAGGCCGAGGCCGCCGGCGCCACCCTCCTCGTCTCCGCCACCGCCACCCACAAGGCGTATGTCCCTTCTCTTAATTAACGA
CTAATTTCCTCTTGTACCATGAATCATTCGCTAGCTAGACATGTTGATACAGCCAATGGATTATATAGTTACTGATGTTTATTGGGATATCTGAACGGAT
GGATGCAGGAGCTCCGGCGGCATGGAGATGGCGGCGGAGAACGGCGGCTGCGGCTGCACCCAGTGCAAGTGCGGCACCAGCTGCGGCTGCTCCTGCTGCA
GCTGCTAGATCGATCATCGACCATATGCATGCACCGTGCCGTGCGTGCATCATCGATCATATCGATCTACTACTACCATACCATGTAACCGCAACCTGAT
CGAGGGCCTTTATCTATGCACCTGACCTGCATCANCAGTCANGTGCCATGCCATGATTGTAAACAGGCCCCCCCTAAATAAAATTTCCCCTGATTANCTA
NAAAAAAAA
page-top