Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig6
Contig Information
Length 683 bp
Tissue Dormant seed with water absorption after breaking
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhei3j23   
Homology (BLAST) Top Hit Thioredoxin-like 1, putative, expressed [Oryza sativa (japonica cultivar-group)]
Score 281
Evalue 6.98834e-48
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig6
CGATTGGCAAGGCCATGAGGTGGTGGGAGAAGGTGACGCACCCCAACATGAGGGAGGTCGAGTCCGCGCAAGACCTCGCCGACTCCCTGCTCAACGCCGG
CGACAAGCTCGTCGTCGTCGACTTCTTCTCCCCCGGCTGCGGTGGCTGCCGTGCGCTCCACCCCAAGGTAGAAATCCTTGGCCGAAAACCCCTGTTCGTT
GCGACAATCTGACTCCAAACACTGTAACGTATGCTAAACAGAAATTCGTTGGTTGTGGTGTGCAGATTGCGCAGTTCGCTGAGCGGAACCCGGACGTGCT
GTTCCTGCAAGTCAACTACGAGAAGCACAAGTCCATGTGCTACAGCCTCCATGTCCATGTCCTCCCTTTCTTCAGGTTCTACAGGGGAGCCCAGGGAAGG
GTCAGCAGCTTCAGCTGCACCAATGCAACCGTAAGTCTCACTTACACACTGTAAAAGATTGTGCGTCTGTTTTCTACGAAAATGTTCTTCAGGCACGTTT
AAGACAGACGAACGCTGACATGCTTGCTGCAATCGCATCTGATTACAGATCAAGAAGTTCAAGGACGCCCTCGCGAAGCACTCGCCGGACAGGTGCAGCC
TCGGCCCGGCGCGGGGCCTCNAGGAGGCGGAGCTCTTGGCTCTGGCTGCAAACAGGGAACCTGGAATTCACCTACAACAACNA
page-top