Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig4
Contig Information
Length 555 bp
Tissue Dormant seed with water absorption after breaking
Clones 1 Clones [Download: CSV  ,  FASTA ]
whei12l02   
Homology (BLAST) Top Hit hypothetical protein OsJ_000428 [Oryza sativa (japonica cultivar-group)]
Score 89
Evalue 0.207796
Total Hit Count 6
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig4
GCTGTGCTGCAGCAGTCGCCGACGGCTTGGCGAAGGGAGGACCGGCGGAAATGGGATTCGCCCTCGTGCCGAATTCGGCACGAGGCCAGAACAGCCCTAA
GAACCTCAAGCGTGGAAAGAGTTACTCCAGATCTCCATCTCCTCGCCGTGGAAGGGTGCGTGATAGGAGCTACAGCAGGAGCCGCAGTAGGAGCTACAGC
CGCTCTGTTTCCCCAAGGAGGGATGAAAGGCGATCAAGGAGCCCCCGTGACAGTCGCAGCCCAAGGAGGAGCCCCCGTGACAGTCGCAGCCCAAGGAGGA
GCCCCCGTGACAGTCGCAGCCCCAGGAGGAGCCCCCGCGACAGTCGCAGCCCTATGAAGAGCCCCCGTGGCAGTCGCAGCCCTATGAGGAGCCCCCGTGA
CAGCCGCAGCCCTAGGAGGAGCGCTTCACCTGCCAAGGGGAGGGCCCGGAGCCCCACCCCTCCTGGCAGCAGGAGCCCTGCACCAAGGGAAAACAGCAGG
AGCCCAATGAANGCTGACAGCCCTAATAACATGAGCCCAGCTGCAAATGGTCGTA
page-top