Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMI_all.Contig2
Contig Information
Length 692 bp
Tissue Dormant seed with water absorption after breaking
Clones 1 Clones [Download: CSV  ,  FASTA ]
rwhei15h11   
Homology (BLAST) Top Hit tropinone reductase 2 [Zea mays]
Score 325
Evalue 1.54867e-28
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMI_all.Contig2
GCTACATCCACTCAAGGAAAGGGTGGTTCAATTGCTCACTAGAATTCCAGTACTAACAGAACAATAGCCCCCCATCCATCTACAGTGTAGAACCAGCAAC
CATTAAAAGATGTCCAATACAGAAACTTTGTAGAAATCCACACTACATACTGACATATACTTATTGTACATGATGACACTAGTTGGCATCACTAATTTAT
TTGTCTATTCACTAATTTTTGTTTCACTCTCCCACACTCTACTTAACTATTCGCCCGAGTAACTTATGCAGTGGTGGTGCTGGCTAATTAAGCGCTAATA
GTTCGACCGCCATCGACACAAATGACCTGGCCGGTGATGAAGGAAGCTGCCGGCATACATAGGAATGCCACCGCCGAGGCGATCTCGACCGGCTTGCCGC
TCCGCAGTAACGGGGTCTTTGAGTGCTCCCGCTCCAAGGACTCTGTATCCATATCTTTGATCATATCGGTTGTGATAAATCCTGGGGCCACGCCATTCAC
ACGGATGTTGTTGGGAGCCCACTCAGCGGCCAAACTCCTAGTAAGCTGGTTCATTGCACTTTTTGTGATAGCGTAGATTGCGGAGCCTACGAAGCCAATT
GAGCCTCCAATGGAGGACATGTTGATGATGCTGCCTCCTCCGGCGTGTACGAGAAGAGGGCGCGCGAGTTGGCANAGATGGAAGCTCGACTC
page-top