Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2330
Contig Information
Length 1918 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 28 Clones [Download: CSV  ,  FASTA ]
whec10d11    whec10f09    whec11d08    whec2m08    whec8h23    whec8l17    whec8o22    whec9b02    whec9m18    whec9o16    whec12h21    whec18g20    whec19i11    rwhec10d11    rwhec10f09    rwhec11d08    rwhec2m08    rwhec5h16    rwhec8h23    rwhec8l17    rwhec8o22    rwhec8p09    rwhec9b02    rwhec9m18    rwhec9o16    rwhec12h21    rwhec18g20    rwhec19i11   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0498700 [Oryza sativa (japonica cultivar-group)] >gi|48475219|gb|AAT44288.1| putative B2 protein [Oryza sativa (japonica cultivar-group)] >gi|51038049|gb|AAT93853.1| unknown protein [Oryza sativa (japonica cultivar-group)] >gi|113579502|dbj|BAF17865.1| Os05g0498700 [Oryza sativa (japonica cultivar-group)] >gi|218197041|gb|EEC79468.1| hypothetical protein OsI_20486 [Oryza sativa Indica Group]
Score 1361
Evalue 5.36219e-148
Total Hit Count 103
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2330
TTTTTTTTTTCACAAAAAAGATGAGACGCCGCAAAATTAATAGGTGCATAAAATTCAGTCACAAACACATATAATCCCCACATTACATAAAACTCTGTCT
TGGAACATAACCAGACTAGAATTAAACAGCTAAATTGGACATAACACAGGTTAAACAGCTTCCACAGCCATAGCAGCAAACACGCCAGGAATCACTAGAC
CATGCCGTCATCCCTCGGTGCCTGGCAGCCTGGATGTAGGATGATGCTTCCGCTGCTCCAAGGCGCCTACTTGGATCGCTGCCTCATCTTTCGGCGCTTC
CTCTTGAGCCTCCTCATCCTCTTCTTCTTCCACTTGGCCCTCATCGCGGCGGCGGAGTCGGCCTCGCTCTCCTTTTCGCGTCGTCGGCGGCGGCGGCGGA
AGTGTGTGGACGGTCAAATGCAAGGTTCCAACTTTCCAAACCAAGGTAAGGTACAGAGACAACAGATACACTCCCAGCATCAACCGCCCTCACTTTGGGG
CATTCATGATGCATCACAACAGTATCCCCCGTCTTTCGGGGGTTTCCCCGCTGGCGGCGGGCATACTGCACTACAAATACATAAATATGAAGAAGAACAT
ACACATCACCGAGATTACGGACAGACGGCACCGACACAGACAGGCTCACATCTTTAGAGGCCTACTTCTTCCGAGTACCAGGTCCTTTCTGGGGGAAATG
CAACCACCAACCAACAGCTTGCGCTTTCATGGACGACGGACGGGACAGATCATTGTGAAAACATCTTCCACAACTTACAGGGATGATATTTACTAAAAAG
AACCACAGAGCAACCACAAACATGTTCCGAAGCAGATCAGGCGTCTTCTGTCTTGCACAGGTCTAGCAGTGACAGTGTCTCTGCTATGGAGAGCTCGAGG
CGGAATTTAGGACCATCATAGTGGTGCAGCACTGGCCTGAAAGCATCCTCTTCCAAGGCCTTGCAAAGCCTTCTAATGCGGATCCTCACCTGTGCTGGGA
ATCTGGATTCACCTTTGCACTTCTTATCTTCCCAAGCAGTGGGATCAATGTTTGATCCTCCAAAACTAGCAGCCTCAAACACCCCATGTAGCTGATGGGT
CGTGTAGTTGTAGAGGAAAAGAGGTAGACCAGGAGTGATGGCTCGGACTGAATCACGATATCTTGCTGGCAAGCCAAAAAGCTGTCTCTTGAGATCCTCC
TGCATGGTATCATTGTTGCAGACAAAGATGTATCCACCAAGAACTTCATTCCTCGGTAGCATCTCGCTTGTTGGCAATGTTTTGAAGCGCTTGTCAACAG
AGTTGTTGTTGCTGTTGCCTCCATTGTTGTTGTTACCACCATTGTGTTTGCCGTTTGCTTCCTTCCCATTCTGATTATTCGGATATTTGTTGACCCCGAC
ATTCATCTTGAATGAATTGACATTACCATTGTTTCCCTTGGGGTACATCGGATTCATGTTATAGGCCATGTTGCGGAAAGGGTACTTCATGGCAGCCTCG
TTCATCTTGAGATCATTCATCTTAAGATCCAGGTTCATGAGGCCAAGATTGAGGTGGTCCATCTTGTTGTCTTCTTGGTGGTAGGATAGCTTATCCCATT
GCTTCACATCAGGGACGGTGTTCATCCGTGCATACTCAAAGTCATTCATCCTCTCAGCCTTTGACTTTGTGATCTCAGCCAGCTTTGATGTCATGAGAGA
CCATTGGCGGTCCTCCACCACCTTTGATTGCCCACGGAACTCATCTCCGAGATGCCACAAGTTGTCCATAGCTCGGTTCAAGCTCTCTGCAAGATTCGGC
GCCGGATTCCGGCGGGGAGGGCGCTGGATTTGGGGAAACTGCTGCGGGGAAGGGGAAGAGGAGGATAGGAGTCGGCTCGGCTGGCTTGGCGTTGGCTCCC
ACTTCGCTCCGCCCACAC
page-top