Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2338
Contig Information
Length 758 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 47 Clones [Download: CSV  ,  FASTA ]
whec10c03    whec4b17    whec4b18    whec4n22    whec7a02    whec7a10    whec7d06    whec7n03    whec8b14    whec9b18    whec14l20    whec15j15    whec16a05    whec16a22    whec16j16    whec16m23    whec16n20    whec18k23    whec19c15    whec19g01    whec19g02    whec19i07    rwhec10c03    rwhec4a22    rwhec4b17    rwhec4b18    rwhec4n22    rwhec7a02    rwhec7a10    rwhec7d06    rwhec7l22    rwhec7n03    rwhec8b14    rwhec9b18    rwhec14k06    rwhec14l20    rwhec15j15    rwhec16a05    rwhec16a22    rwhec16m23    rwhec16n20    rwhec18a24    rwhec18k23    rwhec19c15    rwhec19g01    rwhec19g02    rwhec19i07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit translation initiation factor [Triticum aestivum]
Score 512
Evalue 3.81221e-50
Total Hit Count 309
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2338
TTTTTTTTTTAAGAAAGCATATATTATTATTCAACCTTGATGGGAGAGGGTAACAAGCCATCTAACGATGGTGCTCCTTACAAAGTTTCAACACAAGGGT
AACAAGCATACACGCAGAGAGGTGGGCTATGCTAGATTTTCCGTATACTCAGAGCGCGCAAGCTGGTAACGCCTGCTTGCGCTAGCACACAACTAAATAT
ACTGCACCACCAATATATAGCTGCTTTGCATGTAGACTCTGATATGGAGCTGGCAGTTGTTCAGAAACCATGAATCTTGATGTGTTCCTTCTTCACAATG
CCGGCCTGGACAAGGAAGTTTGAGATGTTCTTCCTCTGATCACCCTGGAGTTGAATGACCTGTCCAAGTTCTGTGTCCTGGACAACTGTACCATTGCAGC
AAAACTCTTTCTTGAGGTCTTTGAGGATCTTGCTGTAGCTGAACTCCTTCTTCAGGCCCTGGACAGTGGTCAGGCTCTTGCGACCATTACGCTGCTGGAT
GCGTACATGAACGTAGTCTTTTGATCCGGCAGCTGCACCAGCGTCCCCAGCATTCGCCTCGGCAAAGGGGTCAAAGGCAGTTGGGATCTGAACGTCAAGA
TCAGACATGAAATCTCCTGGTGAGAGTGGCAAAAGCTACACCAAGAACCTGGGAGGCGGTCGAGGAGGAAGAGATCAACCAAGAACTTTCCCGGGAGGAT
TTGGATCGCGGAGAGGCGCTGGCAGTCAGTCCTTGGTGTTCTTCCTCCTCTTTGGGTT
page-top