Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2321
Contig Information
Length 1484 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 22 Clones [Download: CSV  ,  FASTA ]
whec10b18    whec10k22    whec3o11    whec4a24    whec6o16    whec7a06    whec9b12    whec15f16    whec16c07    rwhec10b18    rwhec10k22    rwhec10l09    rwhec3o11    rwhec4a24    rwhec4b11    rwhec4b12    rwhec6o16    rwhec7a06    rwhec9b12    rwhec15f16    rwhec16c07    rwhec19f04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_08713 [Oryza sativa Indica Group]
Score 1778
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2321
TTTTTTTTTTCAGTAGGATTGGAGGACAATGTATTTAAGGAAAATTGCCCAGTAACGATTCAGGGCACATACTCGAACTCAAACTCAACCCCTATGATAG
TAAATGTTTTGAGAACGCTGCCGCCAACCTACGACAACCTCTGGAGTTCGATGCCTCCACCAAAAACGAATGTTGGGAAAATCCACCCTCTACAGAAATT
ATTGCCTTCCAACGTTAAAAAGATAAAAGTTCGCCAGATCCTTGAAGGGCAGGACTGGGAACAGACTTCTCTTGTTCGTCATCATTTCTTCCCCTCTAGG
CACCGCCTGAGCCGTACTTCTTGCCGAAGAAGAGGATCTGGAGCTGATCATAGCCGGAGAGCACACCAGCACCAGCAATGGCTCGGAGGATGTTGGCACC
AGCACCCTTGAAGAGGGACTTGGCACCCTCCTTCGCCAGGATCTGCTGGAAAGCATCCAAGGAGCTCTTGTACTTGACAGCCTCTCCAGAGGTCATCATC
ATCCTTCTGCGGACGGTGTCAATGGGGTAAGATGCAAGACCTGCACCGTTGGTGATCAACCAACCAAGAGCAAAGCTGGCAAAGAAGTTGTCCTGGAGAG
TGCCAGTGAGGAGAACTGGCTTCAGAGAGTCATACAGTCCAAAGTACAGACCACGGTAGACAATGATTCCAACACAGGAGATGTTGAATCCACGGTAAAG
CCCAGCAATACCATCTGACTTGAGAGTCTTGCGGTAGACATCAACCAGGCCATTGAACTGCCTCTCACCTCCACCCTTGGATGCCTTTGCGTCATTGGCC
AGCCTTGTCCTAGCATAGTCAAGGGAGTACACGAAGAACAGCGAGGAAGCACCAGCTGCACCACCAGAAGCAAGGTTGCCACCGAACCACTTCCAGTAAC
CATCCTTGTCCTTCTTGAAGTTGAACATCCTCTTGAAGTAATCCTTGAATGCAAAGTTCAAAGCCTGAGTTGGGAAGTAACGGATGACGTTAGCAGTGTT
TCCTCTCCACAGTGAGCCAAAGCCTTCATCCTTGATGGTGCGCCCAAAGCAGTCACCAATACCCTTGTATGGCTCAGAGAGCCTGCCAGCCTTGATCATC
TCATCCTGGTTCTGGATAAGCAGCTTAACACGCTCAATAGGAGCTGCAGCAGTCTTGGAAACTGCAGCTGACACTCCTCCCATGAGGAAGTCAATCGCAA
AGTTCTTGACACCTTTCTTCTCAGGGGGTGCATTGGCAAACAATGGAGAAGATGACATCATTGGGACACTGATGCCAAGGTTCTGAGTCATGTAGCTGCT
TGTGGTGAAGCGCCTCTCATAGGATGGCACAGAAGGGCAGATGTTGCGAGCACGAACACCCTCAGAGAAGCTGGAGGCAAGGTGGAACTGTCCACCAAAC
TTCTGCATGACAGACGGGTGGTTAGCACGGTCCGCCATCTCTGACCCTTCGGAAGCGGAGGCGAGGAAGATGGGGTGGTGGCTC
page-top