Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2315
Contig Information
Length 1044 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 19 Clones [Download: CSV  ,  FASTA ]
whec10f04    whec10p13    whec11g05    whec4e19    whec12f06    whec12i08    whec13k21    whec13k22    whec13l09    whec13l10    rwhec10f04    rwhec11g05    rwhec4e19    rwhec12f06    rwhec12i08    rwhec13k21    rwhec13k22    rwhec13l09    rwhec13l10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38068 [Oryza sativa Indica Group]
Score 1091
Evalue 4.77671e-117
Total Hit Count 493
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2315
ACGCTCAGCCCCCAGACGCCGCAGCGCCGCCACTCCACCCGCAGCGGCAACCATGGCGGTCGGCAAGAACAAGCGCATCTCCAAGGGGAGGAAGGGAAGC
AAGAAGAAGGCCGTCGATCCGTTCACCAAGAAGCAGTGGTATGACATCAAGGCGCCGCTGCTGTTCACCAGCCGCAACGTCGGCAAGACCCTCGTGTCCA
GGACGCAGGGTACCAAGATTGCCTCAGAGGGTCTGAAGCACAGGGTGTTCGAAGTATCTCTAGCTGATCTTCAGAACGATGAGGACCAGGCCTACAGGAA
GATCAGACTCCGTGCTGAGGATGTGCAAGGGATGAATGTCCTCACAAACTTCTGGGGCATGGACTTCACCACTGACAAGCTCAGGTCTCTTGTGAGGAAG
TGGCAGACACTCATTGAGGCTCATGTGGATGTGAAGACCACTGACAACTACATGCTCCGCATGTTCGCCATTGGCTTCACCAAGAGACGCCCAAACCAGG
TGAAGCGCACTTGCTATGCCCAAGCAAGTCAGATCAGACAGATCCGCCGCAAGATGGTTGAGATCATGGTCAACCAAGCTGCAAGCTGTGACTTAAAGGA
GCTTGTGAACAAGTTCATCCCTGAGGTGATTGGAAAGGAGATTGAGAAGGCCACCTCAGGCATCTTCCCCCTCCAGAACGTGTACGTCCGCAAGGTGAAG
ATCCTGAAGGCCCCCAAGTTTGACCTGGGGAAGCTCATGGAGGTGCACGGTGACTACAAGGAGGATGTTGGTGTGAAGCTTGACAGGCCTGCTGATGGAG
ATGAGGTGATTCCTGGAGCGGAGGAGGTTGCTGCTGCTGAGTAGAAAATAGAAGTCGCTATTTTGCTGCTTCATATCTAGAAGATGATATATGTGCCACC
TGGGTGTCGTGAACTTTGTAGTCAGTTTTGATGGCTGATTTCTTGAGTACTTCTGTCGACATTCCTAGCCAGCGTTCAGTTATCTTATTTTGTTCGTGTT
ACTTTCTGGATGGAGGTTATGAGTTTAAAACTAAATATTTAGTT
page-top