Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2306
Contig Information
Length 1124 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 17 Clones [Download: CSV  ,  FASTA ]
whec10b19    whec10b20    whec10i19    whec3o10    whec12b02    whec12b13    whec13o22    whec20e06    rwhec10b19    rwhec10b20    rwhec10i19    rwhec3o10    rwhec12b02    rwhec12b13    rwhec13o22    rwhec20e06    rwhec20e17   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cation transport protein chaC [Zea mays] >gi|195630483|gb|ACG36635.1| cation transport protein chaC [Zea mays]
Score 994
Evalue 9.5327e-106
Total Hit Count 441
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2306
TTTTTTTTTTGAAGCAAAGCATCACAACTCAGCGGCGCAGAAGTGCTGAAGTCGCCAAATGCATTTATTATTAGGGTATCACAAGGGAAGCAATAACACT
TGAAGTCTTAGGCTTTCGCATTAGCACTCTGGAAGCTACAGCCTTTGCCACAATAGTTGCCAAAGAAAATTAGCGCACACCCTCAATGGTGCCAGAGCTG
AAGTAAACCACAGATCTTTCAATGGTAGAATGTCAAGAGTGAGTGTGGTCAGAGGAAAATGCCATCTCTTTCGCTGATCCAGCCGTGCTGCTCTTCTTAC
TATGTTGAAACCGCAACGGTGCCCTCAGGAAGAGCAGAGATGTGCACAACAGGTGTATGCGATTTTAATGGTATGTCGGAGCCGGTAACCTTCTTCTCCG
TCGACCTGCTCAGCACCTTCCTCACCTCATCCGCAAGCACAATGATCGAGTCGTCTTCATGGCTTATATTGGACAGTGCCTTCTCCATTGAGAACAGGTA
GTCCCTATTATATCCATTAGGGCCACTGGCTGTAGCAATTTGCCTTGCCATATCCTCCAAAGCAGCAGGGCCAAGATAGTATTTGTTGCCAACTGGATCA
GGAGTGGATACGAAAACTAATACATCCGTCACAGCTGGTTCCAGAGAATTTCCATCCTTGTAGAAATCCACAGAGATCTTCTGGTCATACTCGCATTCTC
TTCTCTCCAAGTACTGCATTGCTTCTCGCTCTTTTTCTAGACCACCTTTGACACAATAAGCAATTCCCCAGCATATGGCTTCATCTTCGGATTCAAGGGT
GCAGGTCCTGGCCGGATGCTGTGGTGTGCCTCTATGGTCAATGCAAGCAAGATTAAACGTTCGCTTGTATCCCTTGATGAATCCCAGGATCTTCTCGTCG
AAGTCGAATCCGGGGTTCCAGATCAGGGACCCATACCCGAAGACCCACAGCACCATCCTGCTGCTGCTTTTCCCCCTGGCCGGAGGAGGGACGCCGGAGA
GAATGCCGCGGGTGGGGTCGGCGGCGCGGGGGGGGGAGCAAGATGGGGATTTGACTCTCCTCTTGCCTCGCCCGCGTCTCCTCTCCTCCGCCGGCGGTCT
TCTCCCCGGGACGGACGGACGGAT
page-top