Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2303
Contig Information
Length 2271 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 17 Clones [Download: CSV  ,  FASTA ]
whec10f12    whec2c02    whec4h16    whec5n24    whec6k05    whec8o04    whec13b24    whec13d15    whec13i05    whec17m03    whec1c02    rwhec10f12    rwhec8o04    rwhec13b24    rwhec13d15    rwhec13i05    rwhec17m03   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit heat shock protein 90 [Triticum aestivum] >gi|110270510|gb|ABG57076.1| heat shock protein 90 [Triticum aestivum]
Score 2129
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2303
CTTCGCCTTCAGGCCGAGATCAACCAGCTCCTCTCGCTCATCATCAACACCTTCTACTCCAACAAGGAGATCTTCCTCCGCGAGCTCATCTCCAACTCCT
CCGATGCCTTGGACAAGATCAGGTTCGAGAGCCTCACGGACAAGAGCAAGCTAGACGCGCAGCCCGAGCTCTTCATCCACATCATCCCCGACAAGGCGAC
CAACACGCTCACGATCGTTGACAGCGGCATTGGGATGACCAAGTCCGACCTCGTCAACAACCTCGGGACCATCGCCAGGTCGGGGACCAAGGAGTTCATG
GAGGCCCTCGCCGCCGGCGCCGACGTGTCCATGATTGGGCAGTTCGGTGTCGGTTTCTACTCCGCCTACCTCGTCGCCGAGAGGGTTGTCGTCACCACCA
AGCACAACGACGACGAGCAGTACGTGTGGGAGTCCCAGGCCGGTGGCTCCTTCACCGTCACTCGTGATACGTCTGGGGAGCAGCTCGGCAGGGGTACCAA
GATGGTCCTCTACCTCAAGGACGACCAGATGGAATACCTTGAGGAGCGCCGCATCAAGGATCTAGTTAAGAAGCACTCTGAGTTTATCAGCTACCCCATC
TCCCTGTGGACTGAGAAGACCACCGAGAAGGAAATTTCTGATGATGAAGATGAGGAGGAGAAGAAGGATACTGAGGAGGGCAAGGTTGAGGATGTTGATG
AGGAGAAGGAAGAGAAGGAAAAGAAGAAAAAGAAGATCAAGGAAGTCTCTCATGAGTGGAACTTGGTCAACAAGCAGAAGCCTATCTGGATGAGGAAACC
AGAGGAGATCAACAAGGAAGAGTACGCAGCTTTTTACAAGAGCTTGACCAATGACTGGGAGGAGCATTTGGCTGTCAAGCACTTCTCTGTTGAGGGTCAG
CTTGAGTTCAAGGCTGTCCTGTTTGTGCCCAAGAGGGCCCCCTTCGACCTCTTCGACAACAAGAAGAAGGCCAACAACATCAAGCTGTACGTGCGCCGTG
TCTTCATCATGGACAACTGTGAGGAGTTGATCCCTGAGTACCTGAGCTTTGTCAAGGGTATTGTTGATTCAGAGGACCTTCCCCTGAACATCTCCCGTGA
GACTCTCCAGCAGAACAAGATCCTCAAGGTCATCAGGAAGAACCTTGTCAAGAAGTGCATTGAGCTCTTCTTTGAGATTGCTGAGAACAAGGAGGACTAC
AACAAGTTCTACGAGGCCTTCTCCAAGAACCTCAAGCTTGGCATCCACGAGGACTCCCAGAACAGGACCAAGATTGCCGAGCTTCTGAGGTACCACTCCA
CCAAGAGTGGCGATGAGCTGACAAGCCTGAAGGACTATGTGACCAGGATGAAGGAGGGACAGAACGAGATCTACTACATCACTGGTGAGAGCAAGAAGGC
TGTGGAGAACTCTCCCCTTCCTTGAGAAGCTGAAGAAGAAGGGCTATGAGGTCATCTACATGGTTGACGCCATTGATGAGTATGCCATTGGTCAGCTCAA
GGAGTTTGAGGGCAAGAAGCTTGTCTCTGCCACCAAGGAGGGTCTGAAGCTTGATGAGAGCGAGGACGAGAAGAAGAAGCAGGAGGAGCTCAAGGAGAAG
TTTGAGGGGCTGTGCAAGGTCATCAAGGAGGTGCTGGGCGACAAGGTTGAGAAGGTTATCGTCTCTGACCGTGTGGTGGACTCCCCTTGCTGTCTGGTGA
CTGGCGAATATGGGTGGACCGCCAACATGGAGAGGATCATGAAGGCCCAGGCCTTAAGGGACTCGAGCATGGCTGGCTACATGTCGAGCAAGAAGACCAT
GGAGATCAACCCTGAGAACGCCATCATGGACGAGCTCCGTAAGCGTGCCGATGCCGACAAGAACGACAAGTCTGTCAAGGACCTCGTGATGCTGCTCTTC
GAGACCTCCCTGCTCACCTCCGGCTTCAGCCTGGAGGACCCCAACACCTTCGGCACCAGGATCCACCGCATGCTCAAGCTTGGCCTGAGCATTGATGAGG
ATGACGAGGCGCCAGAGAACGACACCGACATGCCGCCCCTGGAGGACGACGCCGGCGAGAGCAAGATGGAGGAGGTCGACTAAGCGCCAAGGCTGCCTGT
CGGCTGTCGTCGTCAGATGTCCATGCCCTGCACCGCCTAGTTGTTTTTATCTTAGTGTCGACGTTGGATGGTTTTGGCACGTTTTAGCTGTATCGGTTTT
GTCTTTTGGCTGGCCAAACATTAAGCGCGGTTAGCTGTTTGTGGTACTCGTGGAACAGTTCGTTATTGTTG
page-top