Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2302
Contig Information
Length 1386 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 16 Clones [Download: CSV  ,  FASTA ]
whec10c14    whec10o23    whec11k17    whec3d14    whec12n18    whec15m12    whec20j06    rwhec11k17    rwhec3l14    rwhec5c04    rwhec7k14    rwhec7l01    rwhec7l02    rwhec12n18    rwhec20a07    rwhec20o06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 1621
Evalue 2.51614e-178
Total Hit Count 93
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2302
TTTTTTTTTTATAGACAATAAAGACCATTCGCATAGATGAAAGGATTGCACCACAGTACAGAGGTTCTCATCACGGATCCATGGTTTGAAAAACAAGCAC
AAGTGCCAAATGCTTATTACATCGGATAGCTCGCCATAGCAGGACACAACGACAGGACAGAAACTAAACACACACACTCACGGACACATCACCACCGCCG
ACCGCACACGACTTTTATTCTACCGACGCGGCAACAGATCACAGGCCGATCTCTACCAACTCCGGGTCACGGTGGCGATCAACTCAGCTTCAGCAGCATG
ACACGTTTACCAGGGGAGGATCTTCCAGCGCTGGTTGTCGCCCTCGCACCACTTCCACAGCACGAGGGAGGTGCCGTCGCGAACGCCGCCGTGCTCCTTG
TCGCCGTGGAGAGCGTCAAAGTTGAGGTAGATGTTGTTCACCATGCGGATGCACCGGAAGCCGGCGCCCACGTCGCGGCTCTCAGTCCACAACACTGACT
CGTCCTGGTAGTTGGCGTTGTATGGCACCAGCTTCACAGGGTGGCCCTCGCCTTGGGAGTGCTTGATGGCCTCGCCTGTCACCTTGTTGACGAGGGCGAA
GGCCGGGTAGCCTTCCTCATCCTTGATGCGGTTGCTGTGCCTCATGTCCTTGAACCAGTGCTGGTACTCGTCGCGGGGGTTGGTGGGCGCGAGGACCACA
GCGCCGTTGCGGACGGTGGCGCTGAAGCCGTCGTCGGCCTTGCAGAAGATGCGCACGGTGGGCTCTGTGGAGCCGCCGCGGGGGGCGTTGGCGCTGCCTC
CGGCGTAGGCCTCTTCGCCCCAGGGGAGGATCTTCCAGCTCTGGTTGTCGCCCTTGGCCCACTCCCAGAGGACGACGGTGGTGCCGTCGTGCACGCCGCC
GTGGTCCTTGTCGCCGTTGAGGGCGTCAAAGTTGAGGCGGATGTTGTTCACCATGCGAATGCAGCGGAAGCCCTTGCCGACGTCGCCGCTCTCCGTCCAC
ATCACGGACTCGTCGAGGTACTCCGGGTTGAATGGCACGAGCTTCACCGGGTGGGACTGGCCGAGGGAGTGCTTGACGGCGAGACCAGTGGCCTTGTTGA
CGATGGCGAAGGCGGGGTTACCTTCCTCGTCCTTGATCTGGGTGCTGAAGCGCATGTCCTTGAACCAGTGCTGGTGCTCGTCGCGGGGGTTGGAGGGGGC
GAGGACGACGTTGCCGTCGCGGACGGAGAGGCAGTAGCCCTCGTCGGCCTTGCAGAAGATCTTGAAGGTGGGCTGGTTGCCGCCGCCGGCGGCCGGAGCG
TTGGCAGGGGGGTTCTGGCCATGGTGGCCGTGGTGACCGAAGCCGAACATGCTGTGATCTCTCGGGGGTTTGCGGGACAGAAGGAG
page-top