Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2291
Contig Information
Length 607 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 13 Clones [Download: CSV  ,  FASTA ]
whec6b14    whec7b14    whec18a01    whec18b01    rwhec10c14    rwhec10o23    rwhec3d14    rwhec6b14    rwhec7b14    rwhec15m12    rwhec18a01    rwhec18b01    rwhec20j06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_010264 [Oryza sativa (japonica cultivar-group)]
Score 649
Evalue 3.07164e-66
Total Hit Count 113
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2291
TTTTTTTTTTGAAAAACAAGCACAAGTGCCAAATGCTTATTACATCGGATAGCTCGCCATAGCAGGACACAACGACAGGACAGAAACTAAGCACACACAC
TCACGGACACATCACCACCGCCGACCGCACACGACTTTTATTCTACCGACACGGCAACAGATCACAGGCCGATCTCTACCAAACTCCGGGTCACGGTGGC
GATCAACTCAGCTTCAGCAGCATGACACGTTTACCAGGGGAGGATCTTCCAGTGCTGGTTGTCGCCCTCACACCACTTCCACAGCACGAGGGAGGTGCCG
TCGCGCACGCCGCCGTGCTCCTTGTCGCCGTGGAGAGCGTCAAAGTTGAGGTAGATGTTGTTCACCATGCGGATGCACCGGAAGCCGGCGCCCACGTCGC
GGCTCTCAGTCCACAACACTGACTCGTCCTGGTAGTTGGCGTTGTATGGCACCAGCTTCACCGGGTGGCCCTCGCCTTGGGAGTGCTTGATGGCCTCGCC
TGTCACCTTGTTGACGAGGGCGAAGGCCGGGTAGCCTTCCTCATCCTTGATGCGGTTGCTGTGCCTCATGTCCTTGAACCAGTGCTGGTACTCGTCGCGG
GGGTTGG
page-top