Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2287
Contig Information
Length 904 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 13 Clones [Download: CSV  ,  FASTA ]
whec10f02    whec11g19    whec11g20    whec11n19    whec7g07    whec17n20    rwhec11g19    rwhec11g20    rwhec5a21    rwhec5g16    rwhec7g07    rwhec13m24    rwhec17n20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit heat shock protein 90 [Triticum aestivum] >gi|110270510|gb|ABG57076.1| heat shock protein 90 [Triticum aestivum]
Score 955
Evalue 2.2481e-101
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2287
TTTTTTTTTTATAGAAATATAGCTAACATATAATAGAACCAACAATAACGAACTGTTCCACGAGTACCACAAACAGCTAGCCGCGCTTAATGTTTGGCCA
GCCAAAAGACAAAACCGATACAGCTAAACGTGCCAAAACCATCCAACGTCGACACTAAAGATAAAAACAACTAGGCGGTGCAGGGCATGAACATCCGACG
ACAGGCAGACTTGGCGCTTAGTCGACCTCCTCCATCTTGCTCTCACCAGCGTCGTCCTCCAGGGGCGGCATGTCGGTGTCGTTCTCAGGCGCCTCATCGT
CCTCGTCAATGCTCAGGCCAAGCTTGAGCATGCGGTGGATCCTGGTGCCAAAGGTGTTGGGGTCCTCAAGGCTGAAGCCGGAGGTGAGCAGGGAGGTCTC
GAAGAGCAGCATCACCAGGTCCTTGACTGACTTGTCGTTCTTGTCGGCGTCGGCGCGCTTGCGGAGCTCGTCCATGATGGCGTTCTCAGGGTTGATCTCC
ATGGTCTTCTTGCTTGACATGTAGCCAGCCATGCTCGAGTCCCTCAAGGCCTGGGCCTTCATGATCCTCTCCATGTTGGCGGTCCACCCATACTCGCCAG
TCACCAGACAGCAAGGGGAGTCCACAACACGGTCAGAGACGATGACCTTCTCCACCTTGTCGCCCAGCACCTCCTTGATGACCTTGCACAGCCCCTCGAA
CTTCTCCTTGAGCTCCTCCTGCTTCTTCTTCTCATCCTCGCTCTCATCGAGCTTCAGACCCTCCTTGGTGGCAGAGACAAGCTTNTTGCCCTCAAACTCC
TTGAGNTGACCAATGGCATANTCATCAATGGCGTCAACCATGTAGATGNCNTCATAGCCNTTCTTCTTCAGNTTNTCAAGGAAGGGAGAGTTCTCCACAG
CCTT
page-top