Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2252
Contig Information
Length 782 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 10 Clones [Download: CSV  ,  FASTA ]
whec10f07    whec8g15    whec15f11    whec17e23    whec17j10    rwhec10f07    rwhec8g15    rwhec15f11    rwhec17e23    rwhec17j10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit DEHA2A07084p [Debaryomyces hansenii]
Score 84
Evalue 1.73238
Total Hit Count 47
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2252
CGGCAGTACATATTACAACAGGACCAAAATAGAAAGGAACATTACATTAAGTCCCTGACTTTTACAAGGAGGACCCCAGACTGAAAGCAAGAAACGCGAT
CGGGTCCTTGACAGCCGCCGCCCAGATTGAACCTCGCCGTCGCCGGGGACGAACCACTTGGCACGACGAAATCGCCATGGAAGCATCACCTGCTCGCCAT
AACCTCCGAGCCGCCACTGGAACTGCCTCCCATCAGGCACGCAAGCCGGGAGGAATATAGTCAGCCGCCATTCGGCTAGAAGAAACAGGGCACCTACGAA
GACCGGCAGCCATCGATGGGCGCCGTCGCTCCACCAAAGGGACCTCTGCTGATATGCTCGAACTCGACCTATAAACTTCAGGATTCTGCAACTATCCTGC
TTCTCATCCACCACCATGGTAGCCTGAGAAAACAAGCAGTAGCAGTTGGATGCCCTCCAGATCAGGGAACACCACAACACCAGAACGAGCTTATTCAAGG
GGATCTTGCCAGATCCGGCGTCTTCCACTTTCCACCACCATGGTGGCAAGAAAGAAAACGACGGAGGCCACCACCAGACGCCGCTCGAGAGCTCCAGTGG
TTTGCATCCCCACGGCATAACGCCAGACCACGGCATGAAGCCAAGACAAACTAAAACTACTGCTGCCCTAATATACACAAGGAAGACCCGAGCTCCTCTC
CATATCCATCGCCGGCCGGCAGCGCCGTCGGACGAGGCGTTGGATCGGGCCGGGCAACCCTGGTCGACTCTCAAAAGAGGAA
page-top