Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2240
Contig Information
Length 649 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 10 Clones [Download: CSV  ,  FASTA ]
whec10b01    whec3n14    whec4b13    whec14c16    rwhec10b01    rwhec3n14    rwhec4b13    rwhec14c16    rwhec14h23    rwhec18b06   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ubiquitin-conjugating enzyme [Triticum aestivum]
Score 731
Evalue 1.13008e-75
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2240
TTTTTTTTTTATCATAGATACGACAGAGATTTAACTTAACGGATAACGAAACGTCAGGTAGAACAGACTACCCAGACCCAACGGACTTGACATGGCAAGA
GTACATTCATACGAGTTCAACAGGGGCACGACGGCCTCAAAAGTCCATTCACTTCGTCACGGGGTGGGGTGATACTTTTGGCTGGTTATTTAGGTGATAA
CGGTTCTGGCTCGGCGCATCCATGGTCACCAGCTGGCCGTCAAGCTCTAGCCCATGGCGTACTTCTGTGTCCAGGAGCGCGCCGTGGACTCATACTTGGC
CCTATCAGTCTTGTACATGTGAGCGATCTCGGGCACCAGAGGATCATCGGGGTTCGGGTCCGTCAGCAACGAACAGATTGACAGCAGGACCTTTGATATG
GTCAAAGCCGGGCTCCACTGTTCCTTGAGAATGTCAAGGCAAATGCTGCCGTTGCTGTTGATGTTTGGGTGGAACACCTTGGTGCGGAAAGAGACCTTCG
GGGGCTTGAAGGGGTAATCCGGTGGGAAATGAATGTTCACCAAAAATAGGCCACCGGTGAACGGGCTGTCCGAGGGTCCCATGATAGTGGCCTGCCAGTG
GAACATGTCCTCACCTACAGGACCTGCGCTGCATGAGGTGGGAGGGTCC
page-top