Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2228
Contig Information
Length 1045 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 9 Clones [Download: CSV  ,  FASTA ]
whec10i10    whec14j01    whec18c08    whec1c19    rwhec10i10    rwhec14j01    rwhec18c08    rwhec1c19    rwhec1c20   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein [Bromus inermis]
Score 1221
Evalue 4.04409e-132
Total Hit Count 432
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2228
ATTTAGATACCGGATGAGGTCTCGAAATAGCACTTAATAAGATAAACATCCACATTACATCTAGAGGCAACCACGAGTTCGCAAATCAACAAACATCAGG
CAAAACTTAAAAACGATGGTTCCAGGAACATAGTTCTATATCCTTGCAGATAACTGGCTATAGCAAAACGACTCAACGCCTCAGAATCAGGCCTTGGCAG
CAGCCTGGGCAGCGGCATCCCGCTTCCTCTGCTCCTCAATGATGGTGAGCTTGATACCCTTGCCCTTGGGGAGGCTCACCCATGGCTTGGTGCCCTTGCC
AATGGTGAATACATTGCCCAGACGGGTGGCGAACTGGTGGCCCTGGGCATCCTCAACGTGGATGGTCTCGAAGGTTCCCTTATGCTTCTCCCTGTTCTTG
ATCACACCAACACGCCCAGTGTTGCGCCCGCCAGTCACCATGACCACGTTACCAACGTCGAACTTGATGAAGTCAACAATCTTGTTGGTCTCCAGGTCGA
GCTTGATAGTGTCATTGGCCTTGATGAGAGGGTCTGGGTAGCGGATGGTGCGGCCATCATAGGTGTTCAGGTAGGGGATGCCCTTCTGGCCGAACTGGAC
AGACCTGACCTTGCAGAGCTTGAACTTAGCATCCTCATCCCTGACAGAGTGAAGGCGGAAGCGGCCCTTGGTGTCATACAGAAGCCTGTAGTTCTCACCA
GTCTTGGGAATGGAAATGATGTCCATGAAACCAGCAGGGTAGGTCTTGTCAGTGCGGACCTTTCCATCAACCATGATATGACGCTGCATAAGGATAGACT
GCACTTCACGGTAGGTGAGAGCATATTTCAGTCTGTTCCTCAGGATGAGGATCAGAGGAAGGCACTCCCTGGCCTTGTGAGGACCAGATGATGGCTTGGG
GGCAAAAGCTCCACCAAGCTTGTCAAGCATCCAGTGAGACGGGGCATTGAGCCTCTTCAGATGCTTCTTCAAACCCCTAGCCATGGTTGCGAGCTCGGGC
TAGGTCGCCGTGCTTCTCGTCTTCGGGCACCACCGCCGCCTGCTC
page-top