Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2224
Contig Information
Length 1114 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 9 Clones [Download: CSV  ,  FASTA ]
whec10e05    whec7c20    whec8h14    whec12b20    rwhec8c20    rwhec8h14    rwhec12b20    rwhec12k21    rwhec13a07   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_023685 [Oryza sativa (japonica cultivar-group)]
Score 349
Evalue 5.83084e-31
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2224
TTTTTTTTTTCCAAAAAAAAAATGAAATCCACAATATTCAATACATACAAGCTTACACAAAGACATGCTATCTTAACACAGACAGCATCAGTTGCTCGTG
CACAGCGACTCGCTCGTCCAAGCCTGGATCCTGCAGCAGAGGCTGTTTGCTTAAACTACCAGCACGTACACCGCGTAGATGATCCCCGGTATGTACCCCA
GTATGGTCAGCAAGAGACAGATCCAGAACTCCACGCCGAGTTTGTAGCGCAGGAAGACGCCGACGGGAGGCAGGATGATGGCGAGGATCACCTCCAGGAC
TGTTGCCGAGCCCATGGCTTGCTCACTTCACTCGAGGCCCTCTCCTTTCTTTCTCTCTGCTTTCCCTTCTGAAAGAGGCGACTGGATATTGATCTCCTTC
TCCAGCAAAAGTGAAAATAACACAAAAATCCTCACAGGTTCAACCACATAGCTCCCAACATTACATTCCATTCTTGGGACATCAAAACTCTCTTAATGGG
GGTAAACAAGGAGAGCCTGCTAACAGTTACTAAAGCAAGATGGATAGAACATTCCCGCTACTAGAAAAGGCATTGTCTGGCTTGATGCTTAAACCTCCTG
GACGCTCAAACCTGGTGGGAGGGACTGCTTGAGCTTGTTGGCCTTGTCGGCGTCGAAGACGCAGAGCGTGTAGAGGTACCTGGAGCAGCGCACCTTGAAC
TTGACGGCGTCCTTGGTCCTCTTGATCCGCACCGACCGCGCGTCCTTCCGGCGCGCCGTCAGCAGGAAGTCCTTGATCTCGTGGATCTGCTTCGGCATGG
TGGACGACTGTGCGCACCCGAGGAGAACTCTCCCTTCCTTGAGAAGCTGAAGAAGAAGGGCTATGAGGTCATCTACATGGTTGACGCCATTGATGAGTAT
GCCATTGGTCAGCTCAAGGAGTTTGAGGGGAAGAAGCTTGTCTCTGCCACCAAGGAGGGTCTGAAGCTTGATGAGAGCGAGGACGANAAGAAGAAGCAGG
AGGAGCTCAAGGAGAAGTTCGAGGGTCTGTGCAAGGTCATCAAGGAGGTGCTGGGTGACAAGGTGGANAAGGTCATCNTCTCTGACCGNGTTGTGGACTC
TCCTTGCTGTCTGG
page-top