Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2216
Contig Information
Length 614 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 8 Clones [Download: CSV  ,  FASTA ]
whec11c20    whec3a02    whec9f01    whec9g18    rwhec11c20    rwhec3a02    rwhec9f01    rwhec9g18   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ribosomal protein P1 [Triticum aestivum]
Score 305
Evalue 2.43318e-26
Total Hit Count 341
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2216
CTCCCTGCCTCCTGCGCCTCCACTTCCATCGCCTCCCAAGATCGCAGATCTGCTCCGGTGAGAATCCGTCGCCATGTCTTCCAGCGAGGTCGCCTGCACC
CTTGCCGCCCTCATCCTCCACGATGACGGGATCCCCATCACTTCTGAGAAGATCGCGACGGTGGTGAAGGCTGCCGGAATCAAGGTTGAGGCCTACTGGC
CCGCGCTCTTCGCCAAGCTCCTGGAGAAGAGGAGCGTCGATGACCTCATCCTTTCCGTCGGATCTGGTGGAGGTGGTGCTCCAGCTGCTGCTGCTGCTGC
CCCGGCTGCTGGTGGTGCTGCTGCCGCTGAAGAGAAGAAAGAAGAGAAAAAGGAGGAGGCTAAGGAAGAGAGCGATGATGACATGGGCTTCAGCTTGTTC
GACTAAGCAGTTCAATTCCAGTTCTCCTGTGGAATCTTTTATGCTAAGGATTACTTATCTTATGTGCTTTTAGGTCGAATTTTGCGGATTTAATATGTTT
GAGACCTAAGTATCTGTGCAATGAGTACTGCAAACCACCTTGGGATGGTCTTTTTAGAATGAAAATGGTTTTGGTGCTTGGTTGAAAAGCCATTGCTTGT
TTTGAAAAAAAAAA
page-top