Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2215
Contig Information
Length 1015 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 8 Clones [Download: CSV  ,  FASTA ]
whec4k24    whec4l12    whec4l23    whec1f16    rwhec4k24    rwhec4l12    rwhec4l23    rwhec1f16   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit triosephosphat-isomerase [Triticum aestivum]
Score 1255
Evalue 4.41969e-136
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2215
TAGCAAACATTATCATTATTGGCTTGCAAGCTCAAGTCAGGGGGAGGAAACACAGTAGCAGCTGCTCCACCACAAAATTACTAGCATAGTACACATAATA
AACACAGGAGAGAAAAAAAGGAGTCTCTTCATCTTCGCTGTCTTACTCCACGCCGAAAGGAGCCACGTCGAGATCTTGCTTAGGCAGACTTCACGGTGGC
GGCGTTGATGATGTCGATGAACTCAGGCTTCAAGGAAGCTCCACCAACGAGGAAACCATCGACGTCGGGCTGCGCGGCCAACTCCTTGCAGCTTGCGCCA
GTTACAGATCCTCCATAGATGATCCGCGTGGATTCAGCAACCTCGGGGCTCACATTGGTCTTGAGCCAGTCCCTCAGATTGGCATGGACTTCCTGTGCCT
GAGCCGGTGATGCAACTTTACCGGTGCCAATGGCCCACACTGGTTCATAGGCGACGACCACGTTGGTCCAGTCCTTGATCTTGTCAGCAATTGCTTTTGT
CTGTTCAGCGACAACCGCCATGGTTGATCCAGCTTCTCGCTGCTCAAGAGTCTCACCAACACATGCAATGACCTTCAAGCCCTGAGCGAGTGCATATGCA
ACCTTCTCTCCAACAAACTCGCTTGATTCTCCCATCAAGCTCCTCCTTTCAGAGTGTCCAAGGATGACCCAGGGAACGCCGAGGTTGACAAGCATCTCAG
CACTGACTTCACCGGTGAAAGCACCGCCCTTCTTCACCCAGCAGTTCTGAGCAGCAACTTGGATCTCTGGGCGCAGCTTACCCTTGACGGTGGGAAGGAA
GACATAGGGCGGGCTAACGACAACCTCGACAACATCCGTAGAGGCGATCTGTCCAGCGTTCAGAGTATTGACGATGCTCTCTACCTGTTCGACAGTTCCA
TTGCATTTCCAGTTGCCGCCGACGAAGAACTTGCGGCCCATGGCGACGGAGGAGGAGGGGGGAGATCGGATCGGGTTGGGACGGGCGGACGGGAGAGGGG
GGCTCGAGATGGATT
page-top