Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2196
Contig Information
Length 930 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 8 Clones [Download: CSV  ,  FASTA ]
whec4a23    whec5m02    whec5m13    rwhec10d19    rwhec11n03    rwhec4a23    rwhec5m02    rwhec5m13   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0605900 [Oryza sativa (japonica cultivar-group)] >gi|113565368|dbj|BAF15711.1| Os04g0605900 [Oryza sativa (japonica cultivar-group)] >gi|215707011|dbj|BAG93471.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218195518|gb|EEC77945.1| hypothetical protein OsI_17293 [Oryza sativa Indica Group]
Score 1001
Evalue 1.09177e-106
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2196
TTTTTTTTTTGTCTCAAAACCTCCACATACATAGTCACATTCTTCCAAAAACATGCATCATGGTTCCGAAATATCAAAACTGCATCCACCATCCACTTCC
TAATGTAAAGCAGGCTTAACAAACAAAACATCTTCCGAATACAAGGGGATCATCGATGATCAACCTAGTTCATCCTCCTGACGAGCTGGTTGATGTAGTT
CTCGCGGTTGCCGGCATCACCGCCCTCGACGTAGTGGTTCCTCTTCTTCTTGAGGCCTCCCAGCGGCGCCTTCAGCTTGAAGGGCCACAGGAAGTTGTTG
GCCTCCTTGAAGTGAGGACCGACGGTCAAGATCTCATGCACAAGGTCCTCAATGCAGATGATGTTGTGCTTTCCAAGACCCTCCTCGATGACCTTGTTGT
TGGTCAAAGGAATCCTTTGCTTGTTGAGCTTGCCATAACCTCTTTTGTAGATCAACTCCCTCACACTCTTCAGGTTCGGGTACCCATATGCAACATATGG
CTCGACCCTGCGGAGCATGTTGATGGTGGCCTTGTTAACCTTCAGGAACACTCCATTGAATATCTGTCTCAAACGCAACAGCTGCAAGATCTTCTTGGTC
TTTGGGTGCATGGCATTGATACCTCTGATTCTGACAACAAACAGCAGCTTGGCCTCAGGACTGACATAAAACCCACCCTTCATCCGGGCCTCACGCTTAA
GCTGAACCAACTCCTTGTCCTGGGCATCGTACTCCTCGGCGTACTGCTTGGCGCGGGCGTAGATGACCTTGACGTTCTCGCTGGATTTCTTCTTCTCCTC
GACGGCCTTGGTCTTCTTCTCGGCGGCCCAGAGCTCCTCCCGCTTCCTNTNGAGGAGCACCGANTCCGGCACCACCACCTTCGCCGCCTCGGACGACATC
TNGACGAGCTTCNTNCAGGGGGAGGGAGGA
page-top