Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2178
Contig Information
Length 1118 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 7 Clones [Download: CSV  ,  FASTA ]
whec3m21    whec16g22    whec16h09    rwhec3m21    rwhec4l08    rwhec16h09    rwhec16h21   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0679700 [Oryza sativa (japonica cultivar-group)] >gi|115465371|ref|NP_001056285.1| Os05g0557000 [Oryza sativa (japonica cultivar-group)] >gi|75251381|sp|Q5QM99|RL37A_ORYSJ RecName: Full=60S ribosomal protein L37a >gi|56202147|dbj|BAD73480.1| putative ribosomal protein L37a [Oryza sativa Japonica Group] >gi|113533399|dbj|BAF05782.1| Os01g0679700 [Oryza sativa (japonica cultivar-group)] >gi|113579836|dbj|BAF18199.1| Os05g0557000 [Oryza sativa (japonica cultivar-group)] >gi|125553267|gb|EAY98976.1| hypothetical protein OsI_20934 [Oryza sativa Indica Group] >gi|125595173|gb|EAZ35232.1| hypothetical protein OsJ_018715 [Oryza sativa (japonica cultivar-group)] >gi|194695068|gb|ACF81618.1| unknown [Zea mays] >gi|195605122|gb|ACG24391.1| 60S ribosomal protein L37a [Zea mays] >gi|195607006|gb|ACG25333.1| 60S ribosomal protein L37a [Zea mays] >gi|195610910|gb|ACG27285.1| 60S ribosomal protein L37a [Zea mays] >gi|195618522|gb|ACG31091.1| 60S ribosomal protein L37a [Zea mays] >gi|195621146|gb|ACG32403.1| 60S ribosomal protein L37a [Zea mays] >gi|195622916|gb|ACG33288.1| 60S ribosomal protein L37a [Zea mays] >gi|195625062|gb|ACG34361.1| 60S ribosomal protein L37a [Zea mays] >gi|195626918|gb|ACG35289.1| 60S ribosomal protein L37a [Zea mays] >gi|195658085|gb|ACG48510.1| 60S ribosomal protein L37a [Zea mays] >gi|195658103|gb|ACG48519.1| 60S ribosomal protein L37a [Zea mays] >gi|215765281|dbj|BAG86978.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767573|dbj|BAG99801.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218188844|gb|EEC71271.1| hypothetical protein OsI_03269 [Oryza sativa Indica Group]
Score 481
Evalue 2.89268e-46
Total Hit Count 472
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2178
TTTTTTTTTTAAAAAAAGAGATAAAAACCTTATCATATAAGATTGACTTGGGGTGCAGAGGGGTAGAGAGTGAGAGACGTGTCACAAAAATACAAATAGG
TTGGCATAACGCATAACAGGCAGCTGTAGGGACATACTTTCAAGTTTCAAAGATCCTAAAATCAGAACCAAAATTACTAACAGATATCCATCGCTCGATA
GCCAAAATACAGAGATTGTTAAGTCTTCACTCCACTACAGAACCCCTGGATTCCTCAAGACAACAGTAGGGCAATCATGCTTCGGTCTGCTCCCTCAAGC
GACGGATCGTGCTCCTGACGGTGACTGCACTAGCAGTGTTCATGGTATAGGCGCCGCCAGCCTTGACCTTGCCACAGTCCTTGCATCCCCAAATTCCAAC
AGCTTTCCTCTTCACAGCAAACTTCCCACAGAATTCACAGAAGTACTTGGAGTGCTGAGACACCTCCATCTTCTTGATCTGCTTACGCAAACTGGCACCA
TACCTGGTACCATACTTCCCGACGATTCCGGCCTTCTTGGTGCGCTTCGTCATCTCGGCGGCGGGTAGCAGGAGGCGGCTGCGGCGGCGTAGGCGGGGAG
ATGGCGGCCCTCGTGCCGAATTCGGCACGAGGCCAGTACGTAGCGCAAGCAGAGTTTAGCTCGCTCCCAGCCCGGCCGCTCACCATGTGGACCAAGAAGG
TGGCGACGCAGGTGGTTTTGGTCCTGCTTCTCCTCCTCATCGCACAGGAGGCGGCGGTGCCGGGGGCGGAGGCGAAGATCTGCCGGCAGCGCAGCGCGGG
GTTCAAGGGGCCATGCGTGTCGGACAAGAACTGCGCGCAGGTCTGCCTGCAGGAACGCTGGGGCGGCGGCAACTGCGACGGGCCCCTCCGCCGGTGCAAG
TGCATCAGGCAGTGCTGATCATATGTGGAATGCTACGGCTAGCTGGCCCTCGCCGTACGTCAGNTAGCTAGCCCATGGAGCCATACGTCTGTGTACCTAC
TTGAATGTGTGTGTGTGTGTGTGTGCCCCCTTATACGTACGTATGTCGTATGTATATCCGTGTCGCCACTAGCCAGCTGCTGCATCTCGATCGATGCATG
CAAGATAATAATATGAAG
page-top