Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2177
Contig Information
Length 1313 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 7 Clones [Download: CSV  ,  FASTA ]
whec13n19    whec16c13    whec19k09    whec1g10    rwhec5l01    rwhec19k09    rwhec1g10   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cytosolic malate dehydrogenase [Triticum aestivum]
Score 1628
Evalue 3.61092e-179
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2177
ACTCTCCCTATCCCCGTGTCCAGAAGCTACCCCCCGGCTCCAATGGCGGCGAAGGAACCGATGCGCGTGCTCGTCACCGGCGCCGCAGGACAAATCGGAT
ATGCTCTTGTTCCCATGATTGCCAGGGGAGTTATGCTTGGTGCAGACCAGCCTGTTATTCTGCATATGCTGGATATTGAATTTGCTGCTGAAGCTCTTAA
AGGCGTCAAGATGGAGTTGATCGATGCCGCATTTCCACTTCTCAAGGGAGTTGTTGCAACAACTGATGTTGTCGAGGCCTGCACTGGTGTGAATGTTGCG
GTTATGGTTGGTGGATTCCCCAGGAAGGAAGGAATGGAAAGGAAGGATGTTATGACGAAAAATGTTTCAATCTACAAAGCTCAAGCATCTGCTCTTGAAG
CTCATGCAGCCCCCAACTGCAAGGTTTTGGTTGTTGCCAACCCAGCAAACACCAATGCTCTCATCCTGAAGGAGTTTGCTCCATCTATCCCTGAGAAGAA
CATCAGTTGTTTGACCCGCCTAGACCACAACAGGGCACTCGGTCAGATTTCTGAGAGACTTGGTGTCCAAGTTTCTGACGTGAAGAATGCTATTATCTGG
GGTAATCACTCGTCCAGTCAGTACCCTGATGTTAACCATGCCACTGTGAAGACTTCCAGTGGAGAGAAGCCTGTTCGTGAACTTGTTCAAGATGATGAAT
GGCTAAATGGGGAGTTCATTGCCACTGTCCAGCAGCGTGGTGCTGCAATCATCAAAGCGAGGAAGCTCTCCAGTGCTCTCTCTGCTGCCAGCTCAGCTTG
TGATCACATCCGTGACTGGGTTCTGGGAACCGCTGAGGGAACATTTGTTTCCATGGGTGTGTACTCTGATGGTTCATACGGTGTGCCTGCTGGTCTTATC
TACTCCTTCCCAGTAACGTGCAGTGGTGGTGAATGGACAATTGTTCAAGGGCTCCCGATCGATGAGTTCTCGAGGAAGAAGATGGATGCGACCGCCCAGG
AGCTGTCGGAGGAGAAGGCGCTGGCCTACTCATGCCTCGCGTAAATCCACATTCGAAGGGCAGCTGCTCCTCTGGATGTTTTGAATAAATGAAACCTTCC
GCTCCTTAGAAACTCTCGTCTCCACCCAGAACAGCCGCACATCGCGATGCATGCTCCTTTTCGCTGGTTTTCCCAGTGTGTATGAATGAGGCTTGTAGCT
CCCCTTTTGCCTGATGATTTACAGGACAGTACATTTGCTGCAAGAGTGAAACAATTTGACACCTGATTAGAATCAACTTGTTTTTCTTCTTGAAGCATCT
ACAACAAGTCACA
page-top