Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2155
Contig Information
Length 693 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 7 Clones [Download: CSV  ,  FASTA ]
whec10a23    whec10e03    whec18i01    whec19d19    rwhec10a23    rwhec10e03    rwhec18i01   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L24 >gi|1154859|emb|CAA63960.1| L24 ribosomal protein [Hordeum vulgare subsp. vulgare]
Score 563
Evalue 3.89269e-56
Total Hit Count 458
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2155
TTTTCAAGACAATCCAAAACGTTAACACCATTCAGCCTCAGAGATAAGGTGCAAATTCAAGAGGGCGGGGTAATAACTTGACAAAGGTCTATGATAGTAG
GATAGGAAACAAGGCTAGGCAGCACAACTCTATGTCTATGGCGTAATCAACTTTCAACGCTTCCCGCCGCCACCGCCAATCTTTGGGCCCTTGGAACCCT
TCTGCACGGCGCCCTTGCCCCCCTGTGACTTCTGGGACTTGGTCACCTCTGCCTTCTTGGCCTTCTTCTCATCCTTGGTCTTCTTGATACGCTCCTTGAT
CTCACGGAGAGCGGCTTCTCGGGCAGCATCACGGACTTCAGGCTTCTCGGCCCTCTTCTTCTGGATAACTTCCAGAGTGGCACCAACAATCGACCGTGAG
TACGGCTTCTTGGTGGTGCGGCGCCTCTTCTTGGCAGCCTCAGCATGGATGTCCTTCTTGTGCTGCTTCCTGTACATTGCTGTCCAGCAAAGCTTTGCAG
GCTTCAGGCGGTTGTGGAAGTAGCGCTTGCATTTTGAGTTGGCAAAGAGGAAAACCTGCGAATCCGAACGAATGAACCTGATACCCTTCCCTGGGTAAAT
CTTCTGGCCGCTAAAACGGCAAAGCTCGGTCTTCAGAACCATCTTCTCAGCCTTAGAGAACTTTCACAAGCTCCTACCTTGGGCGAGGAGGAG
page-top