Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Wh_EMC_all.Contig2148
Contig Information
Length 828 bp
Tissue Dormant seed with cold treatment after water absorption
Clones 7 Clones [Download: CSV  ,  FASTA ]
whec10a21    whec10e01    whec19c04    rwhec10a21    rwhec10d03    rwhec10e01    rwhec19c04   
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_016419 [Oryza sativa (japonica cultivar-group)]
Score 117
Evalue 7.02178e-06
Total Hit Count 277
Registered year 2003
Contig Sequence     [ Download ]
>Wh_EMC_all.Contig2148
TTTTTTTTTTGAAGTAAAGAAACATTCAATTGCGACAGAAGTAAAACACAGTGGATCTCAAGATCAACATCAGATTATATACAGGATCAAACTCGGTGCG
TTCATCCGACCATAAAAGACGACCATTCAACACGAAGTTCGATACAAAAGCGAGAACACATAAGAAGAGCCAACTACGGAGACATAATCTTTAAGCATAC
TAACAAGTGGCGTAATTCATCTGCCTTGTCGATATACTTCACAGGGACCCGCCTCACACGAACCCGAGTCTGCAAATCATCACCAGTGGCAATGTTACCC
ACCATGCGCAGAGCTGCAATGAGAATAGAAGTCGACGGGCACAAGAGAAGCTCCACAAGCGAGGAAAAACACCAGACTCAATCACAGCAGGAGGAACACC
CTGATCTGAAGGAGGAAAGATAGTGCCACCCCCTCTTCCATGGCCAAGCACATTCCATCAAGTTTGTAGCTCAAAGCTTGACACATCAAGTTTGGCAAAA
AGGAATATATCAAAAGCTAAGCAGCTTGCTCGATTGCTCAAGAGCGCGCCTATATCAGTAATGGTCAATCATCATTGCACCATATCAGAATTCTTATGAA
CCAAACAACAACAGCAGGGTCTAGCAGTTTCCAACAGTGAACGGGATTCCAAGGCCACTTACAAACTTGCAACTCCACACTTAGTCTGACAAAATGATGA
TGTCAGCCTCACGGCTTCGGTTCCATGTCTCGATAGAGCTTGTGAATAGCTCGCACTACTATCATCTCAAGCGATGGTAGCATAGGGCCCAGATGACCCT
TTTTGTTGGAGGCATGGATGAGGAACTG
page-top